We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Question 8. An operon is a unit of DNA, which contains several ORFs (open reading frames),...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
please help me with the question 15 to 18. Basic structure of an operon Note that the diagram below is one section of DNA master strend with some areas of DNA labeled in blocks The bracketed area illustrates the basic parts of an operon repressor gene promoter operator structural genes DNA 3 mRNA 5 - 3 repressor protein shown attached to operator #2 Repressor preten "Use purple to color in the repressor gene. The repressor gene codes for a repressor...
all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...
Question 7 2 pts Which of these genes would not likely be regulated by the bacterial SOS response?! Translesion DNA polymerase Cell division promoter Holliday junction branch migration enzyme Nucleotide excision repair enzyme Question 8 2 pts Which of these mutations is likely to have the greatest impact on the amino acid composition of the resulting protein? Silent Synonymous Frameshift Missense Question 9 2 pts What would be the result of perfect and continuous suppression of the lac operon in...
DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly and adding nucleotides to the growing daughter strand. Which piece of the machinery accounts for this characteristic? (a) helicase (b) sliding elamp (c) single-strand binding protein (d) primase RNA in cells differs from in that _____ (A) it contains the base uracil, which pairs with cytosine (b) it is single stranded and cannot form base pairs (c) it is single stranded and can fold...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotides, or codon, is the basic unit of storage. The reason for this is that each gene codes for a protein, and all proteins are made from 20 amino acids. Recall that there are 4 different bases that make up dna. Thus, three bases can encode for 4x4x4 = 64 different symbols. Two base pairs can only encode for 4x4 = 16 symbols, which is...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Please answer all questions. Oftentimes, unsaturated fatty acids are found in a fluid state at room temperature (e.g., olive oil). This is because unsaturated fatty acids contain a large number of ___________________. a. Hydrogen bonds b. Carbon-Carbon single bonds c. Carbon-Carbon double bonds d. Sulfide bonds e. Radioactive bonds Which of the following stages of aerobic cellular respiration generates the most ATP? a. Glycolysis b. Pyruvate breakdown c. Citric Acid Cycle (aka. Krebs Cycle) d. Oxidative phosphorylation e. Calvin Cycle...