ZuoTi.Pro
Question

Using sequence GU324922 search Entrez Gene. Write a summary of the information found pertaining to this...

Using sequence GU324922 search Entrez Gene. Write a summary of the information found pertaining to this sequence.

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

it is a sequence of hemoglobin beta subunit of homo sapiens. it is a protein coding gene. mutation in this gene results in beta thalassemia which is milder form of thalassemia major. this gene is conserved in chimpanzee, rhesus monkeys, dogs, mouse and rats. 7 organisms have orthologs(genes in different species evolved frm same ancester) with this gene. gene is involved in various functions such as haptoglobulin binding, oxygen binding, oxygen transporter activity, iron binding activity etc.

0 0
Add a comment
Know the answer?
Add Answer to:
Using sequence GU324922 search Entrez Gene. Write a summary of the information found pertaining to this...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Write a logical expression for a Web search engine to find sites pertaining to coastal wetlands...

    Write a logical expression for a Web search engine to find sites pertaining to coastal wetlands in Louisiana but not in Alabama.

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • Use the following information to answer the questions below. You have isolated a gene sequence f...

    Use the following information to answer the questions below. You have isolated a gene sequence from the mustard plant Arabidopsis and have BLAST searched the NCBI database. Your sequence hit several EST sequences that were identified as transcription factors. These sequences were found in E.coli, Chlamydomonas (a green algae), yeast, mice, and humans and only had a few base pair differences. What can be surmised about your transcription factor? It is unique to Arabidopsis. It is likely involved in a...

  • QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...

    QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho

  • In python! Objective: students will be able to 1.access string elements by index operator 2.search for...

    In python! Objective: students will be able to 1.access string elements by index operator 2.search for simple pattern in strings Specification: Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a trilet TAG, TAA, or TGA. The length of a gene string is a multiple of 3 and the gene does not contain any of the triplets...

  • Q8 - Construct a Binary Search Tree by inserting the following sequence of numbers. 5,6,3,2,10,4,1,7,9,8. Write...

    Q8 - Construct a Binary Search Tree by inserting the following sequence of numbers. 5,6,3,2,10,4,1,7,9,8. Write down the level ordered traversal sequence of the final tree after insert. Delete node 10, 8, and 6 step by step using in-order successor. Write down the level ordered traversal sequence after every delete. I want you to write down (1 level ordered traversal for the insert and 3 level-ordered traversals for the deletes). In total there should be 4 level-ordered traversal sequences in...

  • A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that...

    A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that has been fused to a gene that encodes a protein that is easily observed experimentally. Why is this approach useful? a. It provides information on the binding interactions of the gene product. b. It provides information into where and when a gene is expressed. c. It can provide information as to where a gene is expressed. d. It can provide information as to when...

  • 5. Using arrows, write the flow of genetic information in correct sequence for the following three...

    5. Using arrows, write the flow of genetic information in correct sequence for the following three components: mRNA, protein (amino acid sequence), DNA 14-121 PEA

  • For the unknown sequence shown below, (A) Fnd its corresponding gene in the NCBI Gene database,...

    For the unknown sequence shown below, (A) Fnd its corresponding gene in the NCBI Gene database, (B) find one protein sequence expressed from the gene using the RefSeq database, (C) find the splicing structure of this gene using UCSC genome browser, (D) find its expression pattern across different human tissues using Expression Atlas. >unknown.seq TCAGAGGGAGCAGACACATTTAAATCCTCCTTGTCCTAATTGGCTATGTTCCTAACTTGT                 TTTCTATCACTACAGTGAATGCTGCAATACTGATATAAGAAAAAATAAAATAAAATAGTA                 ACCTCTGCTTCAATGTACAGTTTCCAGAATCTGCCAGAACTGGGGAACTGGGCAACAAGG                 CGTTCATAAGTCTTCCGTGCTTTGTCTATAGGTTGATTCTAAAATTGAAAACCAATAAAC                 AGCATTTACAATGTTAGGATTATGAAAATATTATTCACTGCAGAACCAAGTAGTGTGATT                 GGACCCATAGAGAAGGAAATGTAATCCTATATCACTAAACCTGTGCCTCTCGAATGAGAA                 TGCTCCAAGCATCAAGGTCATATGGATTCTCTTCTAATTTCTTTTCCGCTTTCTTCA

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT