Question

For the unknown sequence shown below, (A) Fnd its corresponding gene in the NCBI Gene database,...

For the unknown sequence shown below,

(A) Fnd its corresponding gene in the NCBI Gene database, (B) find one protein sequence expressed from the gene using the RefSeq database, (C) find the splicing structure of this gene using UCSC genome browser, (D) find its expression pattern across different human tissues using Expression Atlas.

>unknown.seq

TCAGAGGGAGCAGACACATTTAAATCCTCCTTGTCCTAATTGGCTATGTTCCTAACTTGT                 TTTCTATCACTACAGTGAATGCTGCAATACTGATATAAGAAAAAATAAAATAAAATAGTA                 ACCTCTGCTTCAATGTACAGTTTCCAGAATCTGCCAGAACTGGGGAACTGGGCAACAAGG                 CGTTCATAAGTCTTCCGTGCTTTGTCTATAGGTTGATTCTAAAATTGAAAACCAATAAAC                 AGCATTTACAATGTTAGGATTATGAAAATATTATTCACTGCAGAACCAAGTAGTGTGATT                 GGACCCATAGAGAAGGAAATGTAATCCTATATCACTAAACCTGTGCCTCTCGAATGAGAA                 TGCTCCAAGCATCAAGGTCATATGGATTCTCTTCTAATTTCTTTTCCGCTTTCTTCA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans:

(A)  The corresponding gene in the NCBI Gene database is;

Human DNA sequence from clone RP1-85M6 on chromosome 11p12-13 Contains the CSTF3 gene for cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD, PIGCP1 pseudogene (phosphatidylinositol glycan, class C), the gene for a novel protein similar to testis-specific protein PBS13, the gene for a novel 58.3 KDA protein, ESTs, STSs, GSSs and CpG islands

(B) protein sequence expressed from the gene using the RefSeq database

cleavage stimulation factor subunit 3 isoform 2 [Homo sapiens]

(C)

Add a comment
Know the answer?
Add Answer to:
For the unknown sequence shown below, (A) Fnd its corresponding gene in the NCBI Gene database,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Find the human BRCA1 gene transcript mRNA using NCBI refseq database.(hint: accession NM_007299.) (a) What is...

    Find the human BRCA1 gene transcript mRNA using NCBI refseq database.(hint: accession NM_007299.) (a) What is the GI number of the protein? (b) What is the length of the mRNA sequence? (c) Write down the mRNA sequence as it is shown on the database. (d) Also find and write the sequence in FASTA format. (e) How many of each of the four nucleotides A, C, T and G, are there in the genome? (f) How many occurrences of the DNA...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

    You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....

  • three part question!!!! Lab Activity for RNA Processing: p53 Isoforms Isoforms, simply defined, are different proteins...

    three part question!!!! Lab Activity for RNA Processing: p53 Isoforms Isoforms, simply defined, are different proteins created from the same genomic sequence. These differences can be created by a variety of mechanisms, including alternative splicing, the usage of different promoters, and the usage of different start codons. The p53 gene (usually called Tp53) is located on the short arm of chromosome 17 in the human genome. It has some unique gene topography, including one non-coding exon and very long intron...

  • You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

    You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans. Using genome...

  • A cell's genome is its blueprint for life. However, what is the bare minimum number of...

    A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

  • does anyone know what High and low group means in this context? i really do not...

    does anyone know what High and low group means in this context? i really do not understand this article so anyone that does please explain it to me and what the hugh and low group mean in the figures. Received: 21 November 2018 Revised: 27 February 2019 Accepted: 6 March 2019 DOE: 10.1002p28546 ORIGINAL RESEARCnes-highdearee of intra modole connecHvity WILEYa Phypliology ARTICLE Four novel biomarkers for bladder cancer identified by weighted gene coexpression network analysis Zi-Xin Guo | Xiao-Ping Liu...

  • QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into...

    QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
Active Questions
ADVERTISEMENT