am I doing question 1 right? and how do I do questions 2 and 3. can't figure out
Write the complementary DNA strand of the following sequences :
A)
5’-AACGTACGATCGATGCACATGCATGGCTACAT-3’
3’-TTGCATGCTAGCTACGTGTAGCTACCGATGTA-5’
B)
3’-CATGGGTATGCATGTACGTACGTCGTATATCG-5’
5’-GTACCCATACGTACATGCATGCAGCATATAGC-3’
C)
5’-CGCGATCGAGCGATCGACGAATGCCTAGTCAT-3’
3’-GCGCTAGCTCGCTAGCTGCTTACGGATCAGTA-5’
D)
3’-CATAACGAGCTGCTAGCTATTTTTAAAACCCCG-5’
5’-GTATTGCTCGACGATCGATAAAAATTTTGGGGC-3’
E)
5’-CCGCTTTCGCTATTATAAAAAGGGCTATAACAT-3’
3’-GGCGAAAGCGATAATATTTTTCCCGATATTGTA-5’
2.Rewrite the above original sequences as mRNA
3.Using the above mRNA sequences find the polypeptide chain.
1) all th above DNA sequences written are absolutely correct..!! You don't need to change anything in the complementary DNA strand..
2) for converting the DNA sequence to RNA just rewrite the sequence replacing 'T' with 'U'...!! As I have done here..!! Similarly all sequence' 'T' has to be replaced by 'U'..
The RNA sequence will be the same complementary sequence of the template DNA whre' T' is replaced by 'U'. All the 3'-5' will act as a RNA strand sequence..!!
UUGCAUGCUAGCUACGUGUAGCUACCGAUGUA
3) just seeing this table match the triplet code of the nucleotide and match the amino acids coded by it.. U will able to write the protein sequence..!!
am I doing question 1 right? and how do I do questions 2 and 3. can't...
Hello! I am working on this genetics problem and was wondering if you could check my letter d. I am not sure if this mRNA sequence is correct and would really appreciate the help. Thank you! 4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...
Can anyone explain these answers step by step. Especially I do not know how to start question 1 or two!!! Thank you! Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3P-A TIGOTTACTTGCA T-5° DNA 5'- 2) Does it matter which strand is the 'code strand"? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
pls answer all Question 1: The following figures (Figure 1 and Figure 2) show the structure of DNA and of a chromosome. Label each part (A-J) of the figures (hint: D and E refer to the types of bonds formed at these locations) Figure 1. Figure 2. 7 ിപാടിയിലായി CORROS Question 2: The following short sequence of DNA is the sequence of part of a CODING strand of DNA (spaces in sequence are included only for ease of reading). 5'...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
I can't figure out what I'm doing wrong. I used the right formulas and conversions to from cm to m. can someone help please A 3.7 μC (91) and a-30 (q2) charge are placed 1.6 cm apart. At what points along the line joining them do the following things occur? (List all answers as positive numbers.) 16 cm 2 (a) the electric field is zero 842xc 84.2 cm to the left of the negative charge (b) the potential is zero...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...