In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a component of the reaction?
A) fluorescently-labeled deoxynucleotides
B) DNA polymerase
C) a DNA primer
D) the DNA to be sequenced
E) none of the above (i.e. all the above are required in the reaction)
option E)None of the above i.e All of the above is needed in automated DNA sequencing.DNA sequencing is the process of determining the sequence of nucleotide bases (As,Ts,Cs and Gs) in a piece of DNA . Automated DNA sequencing reaction by theSanger method utilizes dye to label the nucleotides instead of a radioactive isotope .The system automatically identifies the nucleotide sequence and saves the information on the computer.In sanger sequencing ,the target DNA is copied many times making fragements of different lengths .Fluroscently labelled deoxynucleotide marks the end of the fragement and allow the sequence to be determined .The role of DNA polymerase is that they catalyze the biological reaction for deriving template sequence information .The role of DNA primer is that when the mixture is heated to denature the template DNA and cooled ,the DNA primer bind to the single stranded template and once the primer has bound ,the tempertaure is raised again ,allowing DNA polymerase to synthesize new DNA starting from the primer .And the DNA sample to be sequenced is combined in a tube with DNA primer,DNA polymerase and DNA nucleotides(dATP,dTTP,dGTP and dCTP).Thus ,all of the option is the component of the reaction.
In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a...
Which of the following is not true regarding both Sanger and Illumina sequencing? Group of answer choices a) Both require DNA polymerase b) Both utilize both standard dNTPs and non-standard dNTPs c) Both require a primer d) All of the above are true for both types of sequencing
O The Sanger method of DNA sequencing requires which of the following to be in the reaction tube? Choose one: O A. template DNA O B. deoxyribonucleotides O C. dideoxyribonucleotides O D. A, B, and C are correct. O E. Only A and B are correct. O F. Only A and Care correct. O O O
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing is limited to simultaneous sequencing of 23 different nucleotide chains at a time b. Next generation sequencing or “sequencing by synthesis”, requires ddNTPs c. DNA fragments generated by the Sanger sequencing reaction each contain a primer incorporated at the 5’ end of the nucleotide chain. d. Primers are labeled with different flurophores allowing all 4 chain termination reactions for Sanger sequencing to be combined...
please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
The Sanger method of DNA sequencing uses which chain-terminating ingredient to separate fragments differing by a single nucleotide a. Magnesium b. Heat c. ddNTPs d. restriction enzymes e. none of the above
1. To conduct the above Sanger sequencing reaction, you add to an eppendorf tube: the DNA you want to sequence, DNA polymerase, dATP, dGTP, dCTP, dTTP, ddATP-green, ddGTP-black, ddCTP-blue, ddTTP-red and what else?
What is a key component in a Sanger DNA sequencing reaction that is absent in normal PCR?
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
Please explain how to identify which lane corresponds to which ddNTP. 44. For the Sanger sequencing of a template DNA sequence 3'-CATGGGCTTTAGTCCT-5', which lane of the agarose gel below represents the reaction mix containing ddATP? a) Lane A b) Lane B c) Lane C d) Lane D e) None of these lanes