O The Sanger method of DNA sequencing requires which of the following to be in the...

Question

Question

O The Sanger method of DNA sequencing requires which of the following to be in the reaction tube? Choose one: O A. template D

Answer 1

Answer #1

Sangere method of DNA sequencing requires The A template DNA, 8. deoxyriboncecleotides and c. dideoxy reeboqucleotides to be

Answer 2

Similar Homework Help Questions

In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a...

In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a component of the reaction? A) fluorescently-labeled deoxynucleotides B) DNA polymerase C) a DNA primer D) the DNA to be sequenced E) none of the above (i.e. all the above are required in the reaction)
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing...

Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing is limited to simultaneous sequencing of 23 different nucleotide chains at a time b. Next generation sequencing or “sequencing by synthesis”, requires ddNTPs c. DNA fragments generated by the Sanger sequencing reaction each contain a primer incorporated at the 5’ end of the nucleotide chain. d. Primers are labeled with different flurophores allowing all 4 chain termination reactions for Sanger sequencing to be combined...
The Sanger method of DNA sequencing requires what type of dNTP modification to generate truncated DNA...

The Sanger method of DNA sequencing requires what type of dNTP modification to generate truncated DNA products? How are individual dNTPs identified? How are the different sizes of DNA separated from each other?

24. Which three of the following six features are common to Illumina and Sanger sequencing technologies...

24. Which three of the following six features are common to Illumina and Sanger sequencing technologies (you will get 1/3 for each correct answer and minus 1/3 for each incorrect answer): Select one or more: a. Both technologies use terminators b. Both methods require PCR amplification c. Both methods require a ligation step d. Both methods require a restriction endonuclease e. Both methods require primers f. Both methods were developed by scientists while under the influence of strong hallucinogenic drugs...
The Sanger method of DNA sequencing uses which chain-terminating ingredient to separate fragments differing by a...

The Sanger method of DNA sequencing uses which chain-terminating ingredient to separate fragments differing by a single nucleotide a. Magnesium b. Heat c. ddNTPs d. restriction enzymes e. none of the above
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger...

ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG

Please explain how to identify which lane corresponds to which ddNTP. 44. For the Sanger sequencing...

Please explain how to identify which lane corresponds to which ddNTP. 44. For the Sanger sequencing of a template DNA sequence 3'-CATGGGCTTTAGTCCT-5', which lane of the agarose gel below represents the reaction mix containing ddATP? a) Lane A b) Lane B c) Lane C d) Lane D e) None of these lanes
The following primer sequence was used in a Sanger sequencing reaction along with the following template,...

The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Selec...

Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Select all that apply.)12.17 a. Complementary single-stranded nucleic acid sequences can come together to form a duplex molecule. b. Single-stranded nucleic acid molecules can be immobilized on certain types of filter paper. c. A DNA strand whose 3' end terminates in a dideoxynucleotide cannot be elongated. d. Duplex nucleic acid molecules can be separated by size by means of electrophoresis. e. New nucleotides are added only to the...

please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction,...

please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...