The following primer sequence was used in a Sanger sequencing reaction along with the following template,...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP?
Primer: 5’ TGGCGCGC 3’
Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’
a. 6
b. 5
c. 4
d. 3
e. 2
Homework Answers
Answer: Sangers sequencing method is chain termination method that required DNA template, primer and dNTPs and ddNTPs. Primer binds to the template DNA and dNTP's complementary to the template strand are added to synthesize the full strand. dNTP has 3-OH that is reuqired to continue the enlogation of DNA strand, whereas ddNTP lacks 3-OH and terminates the DNA strand synthesis upon their incorportaion in the new strand. As the only ddNTP added is ddTTP, chain termination occurs upon its addition and base pairing with adenine (A) nucleotide of the template strand (T is complementary to A). The template strand has three adenine nucleotides and new strand synthesis terminates at three places forming three different products. Hence, option d is the correct answer.
Add Answer to:
The following primer sequence was used in a Sanger sequencing
reaction along with the following template,...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing gel? A C GT a.5' - TTGGCCAAA - 3 6.5' - AAACCGGTT-3' OC. 5'- ATGGACTCA - 3 d. 5'-ACTCAGGTA - 3' e. 5' - TGAGTCCAT - 3'
In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a...
In automated DNA sequencing reaction by the Sanger method, which of the following is NOT a component of the reaction? A) fluorescently-labeled deoxynucleotides B) DNA polymerase C) a DNA primer D) the DNA to be sequenced E) none of the above (i.e. all the above are required in the reaction)
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling...
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing....
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'
Please explain how to identify which lane corresponds to which ddNTP. 44. For the Sanger sequencing...
Please explain how to identify
which lane corresponds to which ddNTP.
44. For the Sanger sequencing of a template DNA sequence 3'-CATGGGCTTTAGTCCT-5', which lane of the agarose gel below represents the reaction mix containing ddATP? a) Lane A b) Lane B c) Lane C d) Lane D e) None of these lanes
O The Sanger method of DNA sequencing requires which of the following to be in the...
O The Sanger method of DNA sequencing requires which of the following to be in the reaction tube? Choose one: O A. template DNA O B. deoxyribonucleotides O C. dideoxyribonucleotides O D. A, B, and C are correct. O E. Only A and B are correct. O F. Only A and Care correct. O O O
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing...
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing is limited to simultaneous sequencing of 23 different nucleotide chains at a time b. Next generation sequencing or “sequencing by synthesis”, requires ddNTPs c. DNA fragments generated by the Sanger sequencing reaction each contain a primer incorporated at the 5’ end of the nucleotide chain. d. Primers are labeled with different flurophores allowing all 4 chain termination reactions for Sanger sequencing to be combined...
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.
please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction,...
please help with all three!
For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing gel? A C GT a.5' - TTGGCCAAA - 3 6.5' - AAACCGGTT-3' OC. 5'- ATGGACTCA - 3 d. 5'-ACTCAGGTA - 3' e. 5' - TGAGTCCAT - 3'
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'
Please explain how to identify
which lane corresponds to which ddNTP.
44. For the Sanger sequencing of a template DNA sequence 3'-CATGGGCTTTAGTCCT-5', which lane of the agarose gel below represents the reaction mix containing ddATP? a) Lane A b) Lane B c) Lane C d) Lane D e) None of these lanes
O The Sanger method of DNA sequencing requires which of the following to be in the reaction tube? Choose one: O A. template DNA O B. deoxyribonucleotides O C. dideoxyribonucleotides O D. A, B, and C are correct. O E. Only A and B are correct. O F. Only A and Care correct. O O O
please help with all three!
For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
Most questions answered within 3 hours.
-
I need to write a research paper and work cited about this
topic: The United States...
asked 23 seconds ago -
Hello! I was wondering if I could have some help?
If the vapor pressure of carvone...
asked 22 minutes ago -
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 41 minutes ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 40 minutes ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 1 hour ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 1 hour ago -
Consider the following reaction: C 2H 2( g) + 2H 2( g) C 2H 6(
g)...
asked 1 hour ago -
Consider a 1.0 L buffer containing 0.092 mol L-1 HCOOH and 0.100
mol L-1 HCOO-. What...
asked 1 hour ago -
Koch Realty has owned a vacant land with a FMV of
$775,000 and an adjusted basis...
asked 1 hour ago -
It is estimated 29% of all adults in United States invest in
stocks and that 85%...
asked 1 hour ago -
What does a 2-sided p value of 0.04 mean? (I am not asking if it
is...
asked 1 hour ago -
A parallel-plate capacitor is made from two aluminum-foil
sheets, each 7.8 cmcm wide and 5.1 mmlong....
asked 1 hour ago