Ans. 5' AGCTTCAGTC3'
Electrophoretic movement of bases occurs from large segments at the application point and smaller fragments moving to opposite end.
Question 5 Not yet graded/2 pts What is the sequence of the template strand? Write your...
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.
The template strand of a given gene includes the sequence 3'-GCCACGTATCA-5' What is the sequence of the nontemplate strand (1 point)? a. 3'-CGGTGCATAGT-5' b. 5'-CGGTGCATAGT-3' c. 5'-CGGUGCAUAGU-3' d. 3'-CGGUGCAUAGU-5' In your own words (2 sentence max), what is an OPERON (3 points)? Explain why a cell needs both mRNA and tRNA in order to synthesize a protein. First, explain the function of mRNA (3 points). Describe in your own words how genetic changes lead to Sickle Cell Hemoglobin (3 points)
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
whats the answer for #15
If the sequence of the template strand is 3'-AATGCTAC-5 then the complementary sequence would be A) 3'-AATGCTAC-5' OB) 3-GTAGCATT-5 C) 3'-TTACGATG-5 OD 3-CATCGTAA-5
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence (make sure to indicate 5' and 3' ends): (5')ATCGTACCGTTA(3')
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
Given the DNA template strand 3\' CGATGAGCC 5\', write the amino acid sequence in the N-terminal to C-terminal direction. Use the three-letter amino acid abbreviations (for example, Glu-Asp-Val).
Given the DNA template strand 3" ACCAAACCG 5', write the amino acid sequence in the N-terminal to C-terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid. (for example, Glu-Asp-Val). Refer to a codon table. amino acid sequence: