Question
please answer All the multiple choice questions in the pic (all pics) i dont need a explantion .

22 Using a bacteriophage to pass DNA rom bacterium to another O A) Transduction O B) Transformation C) Translocation O D) Tra
A segment of DNA wrapped twice around a group of histone proteins is known as a 1 points A) DNA complex B) Chromosome C) Nucl
26 DNA fingerprinting relies on identifying specific A) Coding sequences B) - Non-coding sequences C) Promoters Dj Both a and
30 What possible risks are there to genetic modification of designer babies? A) New forms of illnesses may arise B) May remov
32. The first agricultural product of rDNA was the O O O 33. A) Rot-resistant tomato B) Aphid-repelling eggplant C) Leaf spot
34 Which of the following enzymes is responsible for making a DNA copy from RNA? O A) Reverse transcriptase B) RNA polymerase
36. Which of the following statements is false? A) The cells which take up recombinant plasmids are drug resistant B) Plasmid
What do genes of the lac operon do? A) Code for enzymes necessary for the breakdown of the protein Lac B) Code for enzymes ne
D) Gene inlecion A DNA- or RNA-binding protein that inhibits the expression of one or more genes by binding to the operator o
21 The process of using DNA from one bacterium to alter the characteristics of another is called O O O A) Translation B) Tran
28 Which option most closely relates to how CRISPR-Cas9 works? OA) Measure and cut OB) Cut and paste C) Seek and destroy
0 0
Add a comment Improve this question Transcribed image text
Answer #1

21). C. Transformation

Transformation is a process where cells are made to take up foreign DNA (contained in a plasmid) that is used to alter the characteristics of a cell. This is the only appropriate option since translation is the process of converting RNA to protein, translocation is change is the position of genes and transmutation is the transformation of species into another.

22).A. Transduction

Transduction is defined as the process of transfer of DNA from one bacterial cell to another via a bacteria-infecting virus known as bacteriophage.

23) D. Rosalind Franklin

Rosalind Elsie Franklin was an English, woman scientist and X-ray crystallographer whose work was essential for the understanding of the molecular structure of DNA.

24). C. Nucleosome

The nucleosome is the basic repeating unit of chromatin. it consists of approximately two turns of DNA wrapped around the histone octamer(a set of 8 histone proteins).

25). A. within the polynucleotide chain

Endonucleases are a class of enzymes that cuts DNA into fragments at or near specific recognition sites within the molecules. These sites are called restriction sites.

26) B. Non-coding genes

DNA fingerprinting detects a number of minisatellites in the genome to identify a pattern that is unique to an individual.

27). A. probe

It is a single-stranded molecule of specific sequence that is used to identify a molecule with a complementary sequence.

28). C. seek and destroy

CRISPR cas9 consists of a single-stranded RNA molecule to attach to a target and a protein complex that cleaves the target.

29). D. Bacterial defence from viral infections

Originally CRISPR cas9 was found in Bacteria in order to defend the bacterial cells from viral infections.

30).C. Both A and B

options stated in A and B could be the possible outcomes of gene editing and designing babies with desirable genetic characteristics. It may also lead to less variation, loss of important genes and affordable only by the rich.

31) B. a plasmid or virus carrying genetic material

A vector is a carrier that transports modified genes into a cell by the process of transformation. Plasmids and viral vectors are the most commonly used vectors in genetic engineering.

32). A) rot-resistant tomato

The first agriculture to be produced by recombinant DNA technology is Flavr Savr tomato, that had enhanced shelf life.

33). D. Denaturation, annealing extension

PCR or polymerase chain reaction is the process of in-vitro replication of DNA. It involves 3 steps:

Denaturation is the process of melting the DNA double-strands to produce 2 single strands, annealing is the process of attaching of the primer to the DNA strands and extension is the process of attaching complementary nucleotides to the growing strand by the polymerase enzyme.

34).A. reverse transcriptase

Reverse transcriptase is an enzyme present usually in viruses to produce the respective DNA molecule using RNA as the template.

35).B. Calcium chloride

Calcium chloride (CaCl2) transformation is one of the techniques for the transformation of a cell. the chemical increases the permeability of the prokaryotic cell to uptake plasmid DNA.

36).A. The cells which take up plasmid are drug-resistant.

Although all the options seem true, the cell which takes up the plasmid is not always drug-resistant (may contain other types of selectable markers).

37).B Operon is defined as a set of similar genes that are under the control of a single promoter. It codes for a set of proteins that code for similar functions and is regulated together.

38). C. code for enzyme for the metabolism of lactose sugar.

The lac operon is present in organisms that are capable of utilising the lactose sugar as energy in the absence of glucose. Therefore it consists of genes to metabolise lactose.

39). A. gene expression

Gene expression is the process by which the information encoded in the gene undergoes transcription and translation to synthesise gene products called proteins.

40). B. Repressor protein

The most suitable option is Repressor protein since the question mentions "DNA/RNA binding protein".A repressor molecule binds to the regulatory domain to prevent the expression of a gene.

According to Chegg guidelines, MCQs must contain appropriate explanation along with the answer. Thank you for using Chegg!!

Add a comment
Know the answer?
Add Answer to:
please answer All the multiple choice questions in the pic (all pics) i dont need a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please answer all 3 R (resistant) plasmids confer resistance on their parent organism because OR plasmids...

    Please answer all 3 R (resistant) plasmids confer resistance on their parent organism because OR plasmids encode genes that inactivate drugs. OR plasmids encode enzymes that pump out drugs. OR plasmids encode enzymes that prevent drug uptake. OR plasmids only encode genes, not enzymes all of the above O a, b, and c Which of the following is not a resistance mechanism in microorganisms? O alteration of antibiotic to inactive form O modification of antibiotic target O development of resistant...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • please help me with the question 15 to 18. Basic structure of an operon Note that...

    please help me with the question 15 to 18. Basic structure of an operon Note that the diagram below is one section of DNA master strend with some areas of DNA labeled in blocks The bracketed area illustrates the basic parts of an operon repressor gene promoter operator structural genes DNA 3 mRNA 5 - 3 repressor protein shown attached to operator #2 Repressor preten "Use purple to color in the repressor gene. The repressor gene codes for a repressor...

  • please i need help with a, b, c this is the sequence 5’ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA...

    please i need help with a, b, c this is the sequence 5’ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA GTGATTTTAATTTAAATGAAGCATCCAACGAAAGCTTCTTAGAAAATTGCAATATCA ATAGTTGTGTAGATATAGGTCAT GAAAATGGCAACAAAATAAATAGTCAAGAAAATGAGCATGCTAAAAATAATAACA ACAGTAATAATAACAATTTAAAACC AGAATACAATAATAATAATAATAATTTAAAACCAGAATACAATAATAATAATTTAA AACCAGAGTACAATAATAACAATT-3’ 1. Polymerase chain reaction 5'- ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA GTGATTTTAATTTAAATGAAGCATCCAACGAAAGCTTCTTAGAAAATTGCAATATCA ATAGTTGTGTAGATATAGGTCAT GAAAATGGCAACAAAATAAATAGTCAAGAAAATGAGCATGCTAAAAATAATAACA ACAGTAATAATAACAATTTAAAACC AGAATACAATAATAATAATAATAATTTAAAACCAGAATACAATAATAATAATTTAA AACCAGAGTACAATAATAACAATT-3' a) One strand of a chromosomal DNA sequence is shown above. How would you amplify and isolate a DNA fragment defined by the sequence shown in red, using polymerase chain reaction. Design PCR primers (Forward and Reverse primers, each 20 nucleotides long, that...

  • The diagram below illustrates the LAC operon in its OFF state when the inducer molecule —lactose—is...

    The diagram below illustrates the LAC operon in its OFF state when the inducer molecule —lactose—is absent. Predict the ways in which the following conditions will affect the transcription of the lactose-utilization genes. OPERON Regulatory Promoter Operator_ gene Lactose-utilization genes DNA mRNA RNA polymerase cannot attach to promoter Active repressor Protein If a mutation in the regulatory gene results in a misfolding of the repressor protein so that it can no longer bind DNA, the lactose-utilization genes O Will be...

  • alllll them please all To MOST readily demonstrate transformation of bacteria in the laboratory one could...

    alllll them please all To MOST readily demonstrate transformation of bacteria in the laboratory one could extract DNA from: A) his cells and add the DNA to his cells, then grow the cells on plates with histidine B) hist cells and add the DNA to his cells, then grow the cells on plates without histidine C) lac" cells and add the DNA to lact cells, then grow the cells on plates without histidine D) amp cells and add the DNA...

  • 54. The advantage of a cDNA library of eukaryotic genes compared with a genomic library is...

    54. The advantage of a cDNA library of eukaryotic genes compared with a genomic library is that the cDNA library: a. always has the entire gene sequence b. lacks introns C. contains both introns and exons d. consists of single-stranded DNA e consists of RNA and DNA 55. Which of the following is an example of a cloning vector? a. Human growth hormone b. Mosquito c. Plasmid d. Tick e. Ribosomal RNA 56. Transformation in recombinant DNA technology: a. Requires...

  • for 1-5 define those The Lac operon is an inducible set of genes found in bacteria...

    for 1-5 define those The Lac operon is an inducible set of genes found in bacteria cells that helps the bacteria to metabolize the disaccharide lactose. When it is turned on it produces proteins that pump lactose into the bacteria cell and break it down into glucose and galactose, which can then be used by the bacteria as a source of energy The two figures below show the Lac Operon along with the lacl gene (which regulates the Lac operon...

  • 12. Nucleus 13. Point mutation 14. Deletion mutation 15. Exons 16. Translation 17. Nitrogenous bases H...

    12. Nucleus 13. Point mutation 14. Deletion mutation 15. Exons 16. Translation 17. Nitrogenous bases H bonded 18. mRNA B. Enzyme that unwinds DNA double helix C. Sugar found in DNA nucleotide D. Process of making a protein E. Substitution of one nucleotide base pair for another F. Rungs (steps) of DNA "ladder" G. Transcription occurs in this part of the cell H. Enzyme that synthesizes DNA by connecting bases tha are complementary to the original template stra 1. Removing...

  • please answer all amils A Doon E Conjagants DNA hips o sloning of freign DA fa...

    please answer all amils A Doon E Conjagants DNA hips o sloning of freign DA fa ts are called C Clne D Vecto 20 Whatkind of termini is produced by the retriction endonelease Prl, which restriction site has is 5CGATIC (1he dowswd aow represents the site of cleavage in each strand) D Reverse ends E Polylinker termini A.Y ovehan Byaverhang C Blant ends 21.Eeryme dhat cleave DNA at seuence-specifie sites is called D Exonuclease E Integrase A DNA polymerase Ligase...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT