Homework Answers
Ans- For two codons given in the options- CUC and CUU by replacing single base can be converted from Leucine to Histidine.
Explanation-
Codons for Leucine- CUC, CUU
Codons for Histidine- CAU, CAC.
Add Answer to:
can you explain?
Question 2 For which codon(s) could a single base change account for this...
For which codon(s) of isoleucine could a single base change account for an amino acid change...
For which codon(s) of isoleucine could a single base change account for an amino acid change to methionine? Select all that apply. Select all that apply. A. AUC B. AUU C. AUA D. AUG E.none of these codons
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G...
Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G Tryptophan (Tepl VA Tyrosine (y VAA Stop codon UAG Stop codon EAN: Histidine (His) EA Glutamine (Gip CUU CUC Leuch CCU ICGU CGC eu Arginine (Arg) ICGA ICGG First base Third base soleu ACU ACC AAU A (Asht AG Serine Sen AGA Arginine (AIC) nine Meg: Lysine (Lys) GAU Aspartic GGU GUC Valine (Van) GAC AS GUA GUG 1) Complete the following table AND...
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G Tryptophan (Tepl VA Tyrosine (y VAA Stop codon UAG Stop codon EAN: Histidine (His) EA Glutamine (Gip CUU CUC Leuch CCU ICGU CGC eu Arginine (Arg) ICGA ICGG First base Third base soleu ACU ACC AAU A (Asht AG Serine Sen AGA Arginine (AIC) nine Meg: Lysine (Lys) GAU Aspartic GGU GUC Valine (Van) GAC AS GUA GUG 1) Complete the following table AND...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Most questions answered within 3 hours.
-
Write SQL queries to answer the following question: A. Which
students are enrolled in Database and...
asked 4 minutes ago -
Transverse waves on a string have wave speed 8 m/s, amplitude
0.071 m, and wavelength 0.33...
asked 10 minutes ago -
At −11°C a sample of carbon monoxide gas exerts a pressure of
0.45 atm. What is...
asked 10 minutes ago -
Aqueous hydrobromic acid HBr reacts with solid sodium hydroxide
NaOH to produce aqueous sodium bromide NaBr...
asked 24 minutes ago -
You dissolve 1.0 mole of a substance in water to a total volume
of 1,000 ml....
asked 28 minutes ago -
A company's total assets at the end of last year were 500,000
and its EBIT was...
asked 33 minutes ago -
Is it redundant to say that a pure substance is homogeneous, or
can it not be...
asked 37 minutes ago -
Already famous by the time he arrived at Princeton University in
1933, Einstein had suggested a...
asked 56 minutes ago -
Suppose the average male brain weight (in grams) is estimated to
be 13201320 grams. A 1905...
asked 1 hour ago -
For each molecular substance (a) H3PO2 and (b) C6H5NH2,
calculate its molecular mass and write a...
asked 57 minutes ago -
The inheritance of color blindness in humans is due to a
recessive gene located on the...
asked 1 hour ago -
Aqueous sulfuric acid (H2SO4) reacts with solid sodium hydroxide
(NaOH) to produce aqueous sodium sulfate (Na2SO4)...
asked 1 hour ago