For which codon(s) of isoleucine could a single base change account for an amino acid change...
For which codon(s) of isoleucine could a single base change account for an amino acid change to methionine? Select all that apply. Select all that apply. A. AUC B. AUU C. AUA D. AUG E.none of these codons
Homework Answers
The correct answers are option A, B and C
AUG codes for methionine. Options A,B,C codes for isoleucine. So, a single base pair change of these codons leads to methionine addition during translation.
Add Answer to:
For which codon(s) of isoleucine could a single base change
account for an amino acid change...
can you explain? Question 2 For which codon(s) could a single base change account for this...
can you explain?
Question 2 For which codon(s) could a single base change account for this amino acid change? Leucine (Leu) to Histidine (His) UUG CUA VUA CUG None of these CUC CUU
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic...
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU LAUT UGU UUC (phenylalanin UCCI UAC ) UGCysteine) UUA. serine UAA UUGI (cine) UGG Try tryptophan) CUU CGU CAC hidÌ CGC Ang CAA in CGA Carpinine) CAG plutamine) CGG AUU AAU 1 An AUC (isoleucine) AAC pengine AGC serie) AAA1 Lys AUG MOM AAG sind) AGGI arginine) GCU GAUl Asp GGU GUC Val...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
10) The codon UCA specifies the amino acid serine. a) How many single nucleotide substitutions in...
10) The codon UCA specifies the amino acid serine. a) How many single nucleotide substitutions in this codon could result in chain termination? b) How many single nucleotide substitutions in this codon would fail to change the amino acid?
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a...
4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. According to the genetic code, is this mutation a transition or a transversion? At which position of the codon does the mutation occur? 2 pts
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in...
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________, and the resulting protein has ______________. a) only one codon / at least three amino acid changes b) three codons / a single amino acid change c) only one codon / a single amino acid change d) three codons / three amino acid changes
41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will...
41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will have which sequence in its anticodon e ERNA molecule which furnishes the we a) 3' UGT 5' b) 3' UCA 5. c) 3' ACU 5. d) 3' UGA 5' e) 3' TGA 5 During the replication of DNA, the DNA base sequence S'AGCAT" original strand will generate which of the following sequences on strand? a) 5' ATCAG 3. b) 5 AGCAT 3. c) 5'...
can you explain?
Question 2 For which codon(s) could a single base change account for this amino acid change? Leucine (Leu) to Histidine (His) UUG CUA VUA CUG None of these CUC CUU
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU LAUT UGU UUC (phenylalanin UCCI UAC ) UGCysteine) UUA. serine UAA UUGI (cine) UGG Try tryptophan) CUU CGU CAC hidÌ CGC Ang CAA in CGA Carpinine) CAG plutamine) CGG AUU AAU 1 An AUC (isoleucine) AAC pengine AGC serie) AAA1 Lys AUG MOM AAG sind) AGGI arginine) GCU GAUl Asp GGU GUC Val...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. According to the genetic code, is this mutation a transition or a transversion? At which position of the codon does the mutation occur? 2 pts
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will have which sequence in its anticodon e ERNA molecule which furnishes the we a) 3' UGT 5' b) 3' UCA 5. c) 3' ACU 5. d) 3' UGA 5' e) 3' TGA 5 During the replication of DNA, the DNA base sequence S'AGCAT" original strand will generate which of the following sequences on strand? a) 5' ATCAG 3. b) 5 AGCAT 3. c) 5'...
Most questions answered within 3 hours.
-
Calculate the volume integral of the function T=z^2 over the
tetrahedron with corners (0,0,0), (1,0,0), (0,1,0),...
asked 18 minutes ago -
I propose to you a game. You roll 2 dice. If the sum of the
numbers...
asked 1 hour ago -
Select the most likely lattice types for each of the following
salts: (a) BeF2; (b) CaO;...
asked 1 hour ago -
a
ball is thrown downward with velocity of 10m/s. calculate the final
velocity if it reaches...
asked 1 hour ago -
How many grams of ice at -15°C must be added to 705 grams of
water that...
asked 3 hours ago -
2. Balance sheet
The balance sheet provides a snapshot of the financial condition
of a company....
asked 3 hours ago -
In week 1 of the chemical equilibrium experiment, you and your
lab team will create a...
asked 4 hours ago -
Identify and describe five (5) characteristics of a good KM
measurement system. Be sure to include...
asked 4 hours ago -
What are at least five (5) workplace wellness best practices for
a successful wellness program? Explain...
asked 4 hours ago -
A pharmaceutical company is testing a new drug. Of the 110
people that received the drug,...
asked 4 hours ago -
Which of the following is NOT a mechanism for gene
regulation?
a. Phase variation in DNA....
asked 4 hours ago -
Which of the following is being applied when, under certain
conditions, the value recorded for an...
asked 4 hours ago