10) The codon UCA specifies the amino acid serine. a) How many single nucleotide substitutions in...

Question

Question

10) The codon UCA specifies the amino acid serine.

a) How many single nucleotide substitutions in this codon could result in chain termination?

b) How many single nucleotide substitutions in this codon would fail to change the amino acid?

Answer 1

Answer #1

Answer:

a) 1

There are a total of 64 amino acid combination out of which 3 are stop codons(UGA,UAG,UAA).

Single nucleotide substitution of UCA can either result in UAA (ochre) or UGA (opal) which would immediately result in chain termination.

b) 3 (UCU,UCC and UCG)

UCU, UCC, UCA, UCG, AGU, AGC are the 6 codons that represent the protien serine.

By single nucleotide substitution in UCA we can obtain UCU,UCC and UCG codons that doesnt change the amino acid protien.

Answer 2

Similar Homework Help Questions

Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this...

Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this amino acid sequence. Serine-Alanine-Proline-Aspartic acid Use the codon table to answer the question. UCA-GCG-CCC-GAU UCU-GCU-CCU-GAC CCA-GCA-UCC-GAC UCA-GUA-CCA-AAU UCC-GCA-CCA-GAC
4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a...

4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. According to the genetic code, is this mutation a transition or a transversion? At which position of the codon does the mutation occur? 2 pts
In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...

In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid sequence of a protein. a) Transcription b) Translation c) Coding d) None of the above

Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in...

Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________, and the resulting protein has ______________. a) only one codon / at least three amino acid changes b) three codons / a single amino acid change c) only one codon / a single amino acid change d) three codons / three amino acid changes
For which codon(s) of isoleucine could a single base change account for an amino acid change...

For which codon(s) of isoleucine could a single base change account for an amino acid change to methionine? Select all that apply. Select all that apply. A. AUC B. AUU C. AUA D. AUG E.none of these codons
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

10. Examine more closely how DNA changes in a co questions. Write the codon for the...

10. Examine more closely how DNA changes in a co questions. Write the codon for the DNA sequence ATA then change only one nucleotide so that it codes for an RNA codon that is a STOP codon. If a codon changes to cause an mRNA to have a STOP codon instead of a codon for an amino acid, what type of protein mutation is this? Write the RNA codon(s) for histidine then change the last letter to a "G." What...
, , v Question Completion Sta QUESTION 9 For each of the following amino acid changes...

, , v Question Completion Sta QUESTION 9 For each of the following amino acid changes determine how a mutation in a single base of the mRNA codon (first, second or third nucleotide position) could be altered for the amino acid change to result. Match each change with the position in which the mutation must occur A. 2 B. 1 C. 3 Leu >GIn Phe..>lle ile > Asn AsLys Pro >Ala Phe>Ser 1.5 points Save Answer Click Save and Submit...
How many single base change missense mutations are possible for codon ATG resulting in how many...

How many single base change missense mutations are possible for codon ATG resulting in how many different amino acids? A. 3, 3 B. 5, 3 C. 7, 4 D. 8, 5 E. 9, 6

In addition to the primary amino acid structures of been insulin discovered by F. Sanger, the...

In addition to the primary amino acid structures of been insulin discovered by F. Sanger, the structures of other animal insulins have been determined. The only differences among these insulins lie in a small amino acid sequence adjacent to a cysteine residue. Some of the differences for this sequence are as follows: Beef: ala-ser-val Sheep: ala-gly-val Pig: thr-ser-ile Horse: thr-gly-ile 1) Using a codon chart, could single nucleotide changes account for the observed substitutions in the first ...