Why would you want to exclude low complexity regions from a BLAST search?
The low complexity regions from a BLAST search are removed because cause artifactual hits. If we include low complexity regions it provides high scoring hits leads to false result.
Why would you want to exclude low complexity regions from a BLAST search?
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b....
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
After a BLAST search you find a protein that gave you a bit score of 34. Which arguments would you use to convince your peers that this protein is important to isolate and characterize further?
Which technique would you use if you wanted to < Identify all the regions of open chromatin in a particular cell type? Perform a paternity test? Amplify a specific sequence of DNA? [Choose] [Choose] Promoter fusion DNAse-seq Scanning mutagenesis Western blot RNAseq DNA fingerprinting Northern blot Reporter Assay DNAse footprinting ChIP-PCR EMSA Southern blot DNAse protection assay PCR BLAST search Protein fusion ChIP-seq [Choose Compare the global level of RNA expression between two samples? Detect presence of a specific protein...
Why you need to have multiple indexing schemes if you want to search through a database based on different keys?
Why does the OIG exclude individuals from health care? What impact would hiring an individual have on your long-term care facility?
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry. 7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry.
Why would a company seek to position themselves as low price or high price item in the market place? How might this affect sales dollars, sales volume, and profits? Search and review your course materials for pricing strategies. Search specifically for the word pricing. Summarize the concepts and issues from the course materials.
Suppose you are conducting a study with a total of 50 participants from five different regions of the country, and you want to determine if the average blood pressure is different among these groups. What statistical test would you use?
Why are there multiple results returned when you input a sequence into BLAT or BLAST? How do you know which is most relevant? Does that make the others irrelevant ?