Question

8. How is DNA packaged in eukaryotes? Describe the different fibers and the proteins they use. 9. Define the following: a. Helicase b. Ligase C. DNA polymerase d. Topoisomerase e. Single stranded binding proteins f. RNA primer g. Primase h. Nucleotide triphosphate I. Replication bubble - eukaryote vs prokaryote j. Nuclease k. Chromatin I. Chromosome m. Gene n. Genome o. Promoter 10. What is the function of mRNA 11. What is the mRNA strand that would be copied from this DNA strand? a. GGCTATATCCTGCGCTATACGCTA b. CAATTACGATCCCGGCAATTGGTT 12. DNA polymerase vs RNA polymerase 13. DNA vs RNA 14. What is the primary function of the sigma factor? Is there a protein in eukaryotes that is analogous to the sigma factor? 15. Draw and label a nucleosome. What is the function of the nucleosome?

Answer 1

③ DNA is packed in eukaryotes to form nucleosomes. The nucleosomes is the basic unit of chromation. Nucleosomes are formed by the aggregation of DNA- and histones Histones are the basic proteins rich in lysine and arginine. They are of five types HA H2A combine 2 molecules each of these H2B I H3 to form octamer Hy J This octamer combines with 146 bp of DNA of DNA .. core of nucleosome. 54 bpa act join the 2 together as linker DNA dees to form cores cose In histone binds To conclude H1 molecules each of proteins. to linker DNA is used as a H2A, H2B, H3 & fiber Hu and 2 are used as

(@ • Helicase unwinds the double helical DNA. • Ligase joins the DNA by making phosphodiester bonds. DNA polymerase helps in the replication of DNA. Topoisomerase helps in uncoiling the supercoiled DNA. SSBPs helps in holding the uncoiled DNA to let it be single stranded until replication is not completed. • RNA primer e a short strand of RNA that is required by DNA polymerase to initiate replication. o Primase is an enzyme that synthesizes RNA primer 1. Nucleotide triphosphate like GTP, ATP, CTP and TTP are required for adding new bases to the Ss DNA. • In prokaryotes, circular DNA is there. DNA replicates from a single origin, and the latter grows in two directions from its origin. Leading strand is continuous & legging strand is discontinuous However, eukaryotes have linear DNA they have several replication bubbles. 2 replication fork make 1 replication bubble. o Nuclease enzyme helps in breaking polynucleotide chain of nucleic acid leg. DNA) • Chromatin, thread like structure found in nucleus. o Chromosome are best seen in the metaphase stage. & chromatids Each chromosome shows a pair of e chromatids joined by centromere. Human beings have 46 chromosomes. (153)

o Gene is a unit of inheritance that is carried from one generation to the other. Each gene controls a unique character. • Genome refers to the number of genes present in a haploid cell. o promoter is a sequence present on DNA required for transcription process. Certain components of RNA polymerase recognise promoter and binds to it. (10 mRNA is messenger RNA. It helps in the synthesis of proteins in the cytoplasm. DNA heterogenous RNA MRNA Primary transcript E Nucleus cytoplasm (1) а) 3 GGCТAТATCCTGCGCТAТAC6CTA 5 Template mRNA S' CCGAUA UAGGACGCGAU AUGCGAU 3' Strand DNA (b) MRNA 3' CAATTACGATCCCG GCAATTGGTT 5 Template strand DNA 5' GUU AAUGCU AGGG CCGUUAACCAA 3