Option A "Nonsense" is correct.
Any change in the nucleotide sequences either by mistake when they are copied or due to environmental factors is called a mutation. Amorph is the result of mutation which causes a complete loss of function and mutated gene lost the ability to encode a functional wild-type protein or any new protein. The nonsense mutations are most likely to cause amorph because the nonsense mutation is point mutation (single nucleotide change in DNA ) which is responsible for conversion of a sense codon (codes for amino acids) into a stop codon ( amino acids codon which is responsible for the termination of protein synthesis). This results in incomplete/truncated or fully nonfunctional protein product.
Other options are not right because missense-nonsynonymous is a point mutation that arises as a result of single nucleotide substitution and causes changes in amino acids codon. As a result, a new protein product is formed. Sometimes nucleotide change in the DNA sequence did not cause any change in the encoded protein that is because of the degeneracy of amino acid codon ( because the changed codon also codes for the same amino acid), such mutations are known as missense synonymous mutation. Silent mutations are those mutations that did not affect overall protein function and phenotype. Polymorphism is the presence of a different form of the phenotype of a gene. Polymorphism is the result of mutations and natural selection. So, apart from nonsense mutation, other mutations did not give nonfunctional protein product, therefore option "A" is correct.
What type of physical mutations are most likely to cause an amorph? O A nonsense 0...
What type of physical mutations are most likely to cause a hypomorph? O A nonsense O B missense C frameshift o D silent O E polymorphism
Q12 Homework. Unanswered What type of physical mutations are most likely to cause a hypermorph? O A nonsense O B missense-nonsynomous O C missense - synomous o D silent O E polymorphism 0 F frameshift
1. Indicate which type of physical mutations (nonsense, missense-nonsynonymous, missense-synonymous, silent, polymorphism, frameshift) cause the following results: A. Hypomorph B. Amorph C. Hypermorph
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of X-ray exposure? o A nonsense 0 B missense - nonsynomous o C missense - synomous o D silent O E polymorphism O F frameshift
What type of physical mutation is least likely to affect gene function? A nonsense B missense - nonsynomous C missense - synomous D silent E polymorphism F frameshift
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result of exposure to Oxygen free-radicals? o A nonsense O B missense 0 C silent O D polymorphism O E frameshift
8. Are missense or nonsense mutations more likely to be the underlying cancer causing mutations in a) oncogenes, b) tumor suppressor genes? Explain your reasoning?
1. Which of the following mutations is the most likely to be neutral? A) A nonsense mutation in exon 5 of a gene with 39 exons. B) A splice site mutation in intron 3 of a gene with 8 introns and 9 exons. C) A single nucleotide insertion in exon 7 of a gene with 18 exons. D) A thee nucleotide deletion in exon 1 of a gene with 7 exons.
If the wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the sequence to THE CAT ATT HEB IGR AT? a. missense b. nonsense c. deletion d. insertion e. silent
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...