Answer =
The type of physical mutations are most likely to cause a hypomorph are
A.Nonsense mutation-
Explanation - A hypomorphic mutation a mutation that causes a partial loss of gene function.hypomorph is a reduction in gene function through reduced protein or RNA expression or reduced functional performance, but not complete loss.
Nonsense mutation- Is a type of mutation that changes a codon in a gene to one of the three termination codons.this mutation results in a shortened protein because translation of the mRNA stops at this new termination codon.this mutation occurs a premature nonsense or stop codon is introduced in the DNA sequence.when this mutated sequence is translated into a protein, the resulting protein is incomplete and shorter than normal.
this mutation is results in shorter , unfinshed protein product.
INCORRECT OPTIONS ARE :
B.Missense mutation- The mutation that alters the codon so that it specifies a different amino acid .the result of this mutation is not shortens the protein length.
C.Frameshift mutation = is a type mutation in which small numbers of extra nucleotides being inserted or deleted from the polynucleotide being synthesized.
therefore this mutation result in the abnormal protein product with a n incorrect amino acid sequence that can be either longer or shorter than the normal protein.
D.Silent mutation - mutation without apparent effect called as silent mutation.
E.Polymorphism - is the presence of more than one allele at a particular locus in a particular population.
What type of physical mutations are most likely to cause a hypomorph? O A nonsense O...
What type of physical mutations are most likely to cause an amorph? O A nonsense 0 B missense - nonsynomous 0 C missense - synomous O D silent O E polymorphism
Q12 Homework. Unanswered What type of physical mutations are most likely to cause a hypermorph? O A nonsense O B missense-nonsynomous O C missense - synomous o D silent O E polymorphism 0 F frameshift
1. Indicate which type of physical mutations (nonsense, missense-nonsynonymous, missense-synonymous, silent, polymorphism, frameshift) cause the following results: A. Hypomorph B. Amorph C. Hypermorph
What type of physical mutation is least likely to affect gene function? A nonsense B missense - nonsynomous C missense - synomous D silent E polymorphism F frameshift
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of X-ray exposure? o A nonsense 0 B missense - nonsynomous o C missense - synomous o D silent O E polymorphism O F frameshift
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result of exposure to Oxygen free-radicals? o A nonsense O B missense 0 C silent O D polymorphism O E frameshift
8. Are missense or nonsense mutations more likely to be the underlying cancer causing mutations in a) oncogenes, b) tumor suppressor genes? Explain your reasoning?
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
If I insert two nucleotides into a DNA sequence, what is the most likely mutation? O nonsense missense frameshift silent What is the difference between cross- and self-fertilization? In cross-fertilization insects are used to pollinate the plants, whereas in self- fertilization the investigator pollinates the plants. In self-fertilization the pollen from one plant is used to fertilize the egg from another plant. In cross-fertilization the pollen from one plant is used to fertilize the egg of another plant. In cross-fertilization...
Which type of mutation is likely to be more harmful? Substitution O Frameshift O Silent mutation Missense Point mutation What is the coding portion of a gene called? O Exon O Transcript Intron mRNA Okasaki fragment