2. The sequences of 13 promoters recognized by σ70 factor of RNA
polymerase have been aligned below. Deduce the consensus sequences
for the -10 and -35 regions of these promoters. The TSS is
highlighted. Do your consensus sequences agree with the actual
consensus sequences? If not, why? 
Homework Answers
promoter contains two short sequence elements
-10 (Pribnow Box) and TATAAT Sequence
-35 nucleotides TTGACA sequence
Both are located upstream from the transcription start site.
TsS in bacteria contains either or G base at TSS. .
Here in the above promoter example none of the promoter has all 3 sequence similar to actual consensus sequence which are mentioned above in the answer
Add Answer to:
2. The sequences of 13 promoters recognized by σ70 factor of RNA
polymerase have been aligned...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
Please help with 1-16!!! (two pictures are attached) Thanks! Transcription . Although both prokaryotes and eukaryotes...
Please help with 1-16!!! (two pictures are attached) Thanks!
Transcription . Although both prokaryotes and eukaryotes put a cap and a tail on the mRNA, only eukaryotes have introns that have to be spliced out. (T/F) 2. The poly A tail on cukaryotic mRNA protects the RNA from rapid degradation in the cytoplasm. (T/F) 3. The polyA tail is added to eukaryotic mRNA immediatel after transport of the message from the nucleus. (T/F) 4. is usually a single stranded molecule....
Sorry for bad grammar, English is not my native language. For question 11 what is a...
Sorry for bad grammar, English is not my native language.
For question 11 what is a haploid yeast cell? If the cell lacks
the promoter in the first then will it always be true
that expression will not occur despite the UAS sequence?
What is a UAS sequence?
For question number 13 response b how/why when a promoter is
closer to a consensus sequence more transcription occurs?
11. Galactose dependent transcription is regulated by the Gal4 transcription factor which binds...
choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...
choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
2. One personality dimension that seems well recognized by most people is that of introversion-extroversion. Extroverts...
2. One personality dimension that seems well recognized by most people is that of introversion-extroversion. Extroverts are described as outgoing, sociable, and fun-loving, whereas introverts are described as reserved and less sociable. Because introverts seem more directed toward their own thoughts and ideas, we might suspect that introverts and extroverts may respond differently to external stimulation such as noise. To more fully investigate this issue, Standing, Lynn, and Moxness (1990) used a 2 ✕ 2 between-subjects design to vary personality...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions...
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
Please help with 1-16!!! (two pictures are attached) Thanks!
Transcription . Although both prokaryotes and eukaryotes put a cap and a tail on the mRNA, only eukaryotes have introns that have to be spliced out. (T/F) 2. The poly A tail on cukaryotic mRNA protects the RNA from rapid degradation in the cytoplasm. (T/F) 3. The polyA tail is added to eukaryotic mRNA immediatel after transport of the message from the nucleus. (T/F) 4. is usually a single stranded molecule....
Sorry for bad grammar, English is not my native language.
For question 11 what is a haploid yeast cell? If the cell lacks
the promoter in the first then will it always be true
that expression will not occur despite the UAS sequence?
What is a UAS sequence?
For question number 13 response b how/why when a promoter is
closer to a consensus sequence more transcription occurs?
11. Galactose dependent transcription is regulated by the Gal4 transcription factor which binds...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
Most questions answered within 3 hours.
-
The operations manager of a mail order house purchases double
(D) and twin (T) beds for...
asked 2 minutes ago -
Maths
asked 44 minutes ago -
Maths
asked 57 minutes ago -
1. You have genotyped an entire population of lab mice for a
single locus (let's label...
asked 1 hour ago -
As part of the process for improving the quality of their cars,
Toyota engineers have identified...
asked 1 hour ago -
What is the relationship between the number of coils in a
solenoid and the emf induced...
asked 2 hours ago -
cell in human body reproduces. what process does it use? describe
the steps in the cell...
asked 3 hours ago -
The cheetah is one of the fastest accelerating animals, for it
can go from rest to...
asked 4 hours ago -
CaCO3 (s) ⇌ CaO (s) + CO2 (g)
At 637 °C, the reaction reaches equilibrium.
If...
asked 5 hours ago -
The condensate from a steam distillation contains 12.0 g of
compound A and 18.0 g of...
asked 8 hours ago -
A major economic benefit of fixed exchange rates compared to
floating rates is that
a. the...
asked 8 hours ago -
1) For this reaction,
SiCl4 (l)+ 2H2O(g) <->
SiO2 (s) + 4HCl (g) DeltaH = -127 KJ...
asked 8 hours ago