Homework Answers
Before you add your DNA sample into the well you need to add loading buffer (aka loading dye) to your sample as this will give you viscosity to your sample and let the sample settle in the well and also this dye will help you monitor the movement of the dye on the agarose gel.
If you want to estimate the sizes of the DNA fragments in the gel, we would have to load size standard (AKA marker DNA) alongside your DNA samples
Add Answer to:
Before you add your DNA sample to your well, what do you have to add to...
1. What is the purpose of the sample buffer? 2. What would happen if you did...
1. What is the purpose of the sample buffer? 2. What would happen if you did not add the sample buffer before loading your DNA sample on the gel? 3. What is the purpose of the blue dye?
And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Can anyone show me step-by-step on how to do the agarose calculations? This week we will...
Can
anyone show me step-by-step on how to do the agarose calculations?
This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
TTC ach of the DNA fragments on your gel can be determined using another method th...
TTC ach of the DNA fragments on your gel can be determined using another method th The number of base pairs in each of the DNA fragments the size of the known framments from the DNA marker against her method that can be more accurate. This involves graphing ents from the DNA marker against the distance each fough the gel to generate a standard curve. This is most DNA band moved through the gel, to generate a conveniently done on...
So far in class I have learned c1v1=c2v2....it is said v1 is usually unknown. I am...
So far in class I have learned c1v1=c2v2....it is said v1 is usually unknown. I am unsure how to solve this problem. 1.You have 23 uL of plasmid DNA that you want to run on a gel, but you only have 7X tracking dye. How much 7X tracking dye would you add to your sample before loading it on the gel?
Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
1. What is the purpose of the sample buffer? 2. What would happen if you did not add the sample buffer before loading your DNA sample on the gel? 3. What is the purpose of the blue dye?
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Can
anyone show me step-by-step on how to do the agarose calculations?
This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
TTC ach of the DNA fragments on your gel can be determined using another method th The number of base pairs in each of the DNA fragments the size of the known framments from the DNA marker against her method that can be more accurate. This involves graphing ents from the DNA marker against the distance each fough the gel to generate a standard curve. This is most DNA band moved through the gel, to generate a conveniently done on...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Most questions answered within 3 hours.
-
A χ2-curve, looking at the relationship between age and hours
spent working at an office per...
asked 11 minutes ago -
The pH of a sample of water from a river is 5.0. A
sample of effluent from...
asked 56 minutes ago -
At the beginning of the period, the Fabricating Department
budgeted direct labor of $136,500 and equipment...
asked 1 hour ago -
Please answer all
____ 28. Rent control is usually
justified on the grounds that it protects...
asked 1 hour ago -
PARTS A-D HAVE BEEN ANSWERED. WAS TOLD TO REPOST. ONLY ANSWER
PARTS E and F.
A...
asked 1 hour ago -
2) You are given the task of finding a representation for a
circle in a drawing...
asked 2 hours ago -
STUDY QUESTION: Does use of diet drug fen-phen
(fenfluramine-phentermine) cause valvular heart disease?
HINT: Valvular heart...
asked 2 hours ago -
1. An object weighing 40 N rests on a surface. The coefficient
of friction is 0.35....
asked 3 hours ago -
Investor company owns 35% of investee company voting stock and
accounts for the investment under the...
asked 5 hours ago -
The number of major faults on a randomly chosen 1 km stretch of
highway has a...
asked 5 hours ago -
Consider the competitive environment of Starbuck's, Progressive
Insurance, a manufacturing firm with low turnover, or a...
asked 6 hours ago -
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 8 hours ago