And..
Exercise1:
Give the basic steps involved in extracting genomic DNA from animal cells and tossues?
for these {23,24,26} questions i gave correct answers and explanation too. i was tried to answer 25th question also but i didn't get exact answer for it. i hope so these three answers will helpful to you.
please click like button if these answers are helpful
thank q
And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...
Based on the migration of 3 DNA fragments {A, B, & C) of the indicated sizes (where kb = kilobases, ie thousand base pairs) in these gels, which of the following statements is correct? А В С А В С kb 0.5 Gel #1 Gel #2 Select one: a. Gell #1 has a higher % agarose than gel #2 b. An 8% acrylamide gel would give greater resolution of fragments larger than 500 bp than either of these gels. c....
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
please help if you can 3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You proceed to treat the DNA molecule with different cutting enzymes and then you run the individual reactions on a gel. The following gel is produced with each column representing a different reaction (lane). In lane 1 a molecule weight ladder is run. In lane 2, the circular DNA is NOT treated with any enzyme. In lane 3 the DNA is treated with an enzyme...
Prac result Nhel Kpn I 1569 1601 Kpni 1030 2295 / 2310 Not I 988 ОТС-д Sphi 2559 Nde I 484 POTC-A 6401 bp Hygro Amp Nde1 3369 pUC Ori 5260 4587 Amp: Ampicillin resistance gene 5405 - 6265 Hygro: Hygromycin resistance gene Choose the gel image with correct bands in lanes 1 to 5 to indicate the approximate positions where you expect to see these predicted DNA fragments. (1 mark) Lane 1: POTC (undigested / uncut) Lane 2: POTC-A...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
draw a southern blot in which genomic DNa frow WW rabbits, Ww rabbits pink, and ww rabbits white has been digested with EcoRI and hybridized to probe A 3. You have discovered a coat color gene ("W" gene) in rabbits that has two alleles, W and w. Rabbits that are homozygous for W (WW) are red. white. Heterozygous rabbits (Ww) are pink. Rabbits that are homozygous for w (ww) are You have also identified a DNA sequence of about 100...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....