Homework Answers
Generally for larger molecules lower concentration of gel gives more separation. Here gel 2 is less separated means it has a relatively higher concentration.
So option C gel 2 has a higher % agarose than gel1 is the correct answer.
hope you understood my answer. Please rate my answer to show some love!
Add Answer to:
Based on the migration of 3 DNA fragments {A, B, & C) of the indicated sizes...
And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
The PCR was a success and your target region of 770 bp in length has been...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
3. Sam received the sequence above on the copy of the chromosome 2 he received from...
3. Sam received the sequence above on the copy of the chromosome 2 he received from his mother. The copy he received from his father has 8 repeats on the same STR. a. What is Sam's genotype? b. If you used the primers you designed in question 1 to amplify this region of the genome from a preparation of DNA from Sam and then ran the PCR products on an agarose gel, how many bands do you think you would...
I need the answers for questions 2 and 3. My DNA ladder is in lane 2...
I
need the answers for questions 2 and 3. My DNA ladder is in lane 2
marked by the yellow arrow. Thanks!
Here is the only other info I have. Thanks!
Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration;...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
3. Sam received the sequence above on the copy of the chromosome 2 he received from his mother. The copy he received from his father has 8 repeats on the same STR. a. What is Sam's genotype? b. If you used the primers you designed in question 1 to amplify this region of the genome from a preparation of DNA from Sam and then ran the PCR products on an agarose gel, how many bands do you think you would...
I
need the answers for questions 2 and 3. My DNA ladder is in lane 2
marked by the yellow arrow. Thanks!
Here is the only other info I have. Thanks!
Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
Most questions answered within 3 hours.
-
1-Write an algorithm to get two numbers from the user (as
inputs) and calculate the sum...
asked 2 hours ago -
Define white-collar crime. What is the difference between
offender and offense-based definitions of white-collar crime? What...
asked 2 hours ago -
Consider a reaction which is 1st order with respect to A and 1st
order with respect...
asked 3 hours ago -
c++
The length of the hypotenuse of a right-angled triangle is the
square root of the...
asked 3 hours ago -
When a metal rod is heated, not only its resistance but also its
length and cross‐sectional...
asked 3 hours ago -
write a c++ program that computes the L^1 - Norm of a given
vector (L^1 norm...
asked 3 hours ago -
A manufacturer of banana chips would like to know whether its
bag filling machine works correctly...
asked 3 hours ago -
Complete the chapter case, "Turnover Analysis".
Chapter Case
Turnover Analysis
You recently completed your company’s new...
asked 3 hours ago -
What is the pH of solutions having the following H3O+
concentrations? Identify each as acidic, basic,...
asked 3 hours ago -
How does over-voltage of the diode usually occur?
asked 3 hours ago -
If you step on a dirty nail, your doctor will recommend you
update your Tetanus vaccination....
asked 3 hours ago -
Suppose that decreases in the price of milk lead to decrease s
in the retail prices...
asked 3 hours ago