In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)
DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
Homework Answers
Dideoxynucleotides are inhibitors of DNA polymerase used in Sanger chain method of dna sequencing.
ddGTP will sequence the DNA strand at following positions:-
1. ACTG
2. ACTGAG
3.ACTGAGATCG
4.ACTGAGATCGG
5.ACTGAGATCGGATCCTG
6.ACTGAGATCGGATCCTGATATAG
7.ACTGAGATCGGATCCTGATATAGC
At the end of sequencing we will have total 7 fragments of DNA.
Add Answer to:
In order to sequence a strand of DNA, all four dNTPs,
ddGTP, DNA polymerase and primers...
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and...
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts)...
Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts) and label the reaction was conducted on the b. Read the sequence A DNA sequencing was template strand in a thin capillary gel tube containing primers, DNA polymerase, deox yribuneeleotides and|メイenmcaT luorescently tagged dideoxyribunecleotides and a e. The smallest fragment is computer was used to record the fluorescent peaks during fluorescently tagged with (A)ddATP (B) ddGTP (C) ddCTP (D) ddTTP was used to reoribunecleotidesnanTCAATGaTa...
3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix...
3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix (containing ATP, CTP, dGTP, and dTTP), and ddGTP. In this way, when the DNA polymerase incorporates a nucleotide carrying guanine into the growing DNA strand, it will use sometimes dGTP and sometimes ddGTP. When ddGTP is used, the DNApol will no longer add nucleotides to the DNA strand. For ala3, write below three the possible molecules produced. For b1-b3, consider that you used ddATP...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA...
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase that lacks 5'+3' exonuclease activity but has 3-5'exonuclease activity and polymerase activity. What will be the structure of the final product and what is the first step in the reaction sequence? 3' OH-TGCGAATTAGCGACAT-P5' 5'P-ATCGGTACGGCGCTTA-P 3' 12. You are screening a chemical for potential mutagenicity using the Ames test. You used a his-S. typhimurium bacterium for this test and obtained the following results: Chemical +...
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts) and label the reaction was conducted on the b. Read the sequence A DNA sequencing was template strand in a thin capillary gel tube containing primers, DNA polymerase, deox yribuneeleotides and|メイenmcaT luorescently tagged dideoxyribunecleotides and a e. The smallest fragment is computer was used to record the fluorescent peaks during fluorescently tagged with (A)ddATP (B) ddGTP (C) ddCTP (D) ddTTP was used to reoribunecleotidesnanTCAATGaTa...
3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix (containing ATP, CTP, dGTP, and dTTP), and ddGTP. In this way, when the DNA polymerase incorporates a nucleotide carrying guanine into the growing DNA strand, it will use sometimes dGTP and sometimes ddGTP. When ddGTP is used, the DNApol will no longer add nucleotides to the DNA strand. For ala3, write below three the possible molecules produced. For b1-b3, consider that you used ddATP...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase that lacks 5'+3' exonuclease activity but has 3-5'exonuclease activity and polymerase activity. What will be the structure of the final product and what is the first step in the reaction sequence? 3' OH-TGCGAATTAGCGACAT-P5' 5'P-ATCGGTACGGCGCTTA-P 3' 12. You are screening a chemical for potential mutagenicity using the Ames test. You used a his-S. typhimurium bacterium for this test and obtained the following results: Chemical +...
Most questions answered within 3 hours.
-
han discusses the racist practice of badlands, a bar
in the Castro
district of San Francisco,...
asked 33 seconds ago -
A sample of final exam scores is normally distributed with a
mean equal to 25 and...
asked 4 minutes ago -
An investor shorts 100 shares of a stock when the share price is
$50 and closes...
asked 8 minutes ago -
LLOP corporation just paid 4$ dividend per share, you expect the
dividend to grow 8% for...
asked 17 minutes ago -
if we subtract 1000 from 0001 is there overflow? (binary)
asked 25 minutes ago -
Hello, I need help with the function below, The language I am
using is Ocaml
open...
asked 26 minutes ago -
Explain how the presence of glucose represses the gal structural
genes?
asked 34 minutes ago -
For the reaction CaI2+2AgNO3⟶2AgI+Ca(NO3)2 how many grams of
silver iodide, AgI, are produced from 56.5 g...
asked 46 minutes ago -
Write an equation for hydrolysis via acid catalysis.
Using ethyl acetate, ethyl benzoate, ethyl formate or...
asked 53 minutes ago -
Only one graph is needed.
(a) Draw a Supply Curve and the Demand Curve for the...
asked 56 minutes ago -
Fill in the blanks and please show how you arrived at numerical
answers
. The...
asked 56 minutes ago -
91. If the half – life of a sample of radioactive
material is 60 days, what...
asked 1 hour ago