4 The process by which chemical information encoded in DNA is copied into RNA is known...
Check Your Understanding (p.206) 2.1 The majority of mtDNA is transmitted maternally. (Circle the correct answer.) TRUE / FALSE 2.2 If two brothers were killed in a plane crash, would it be possible to determine the identities of the remains based on mtDNA? Explain your answer Chapter 14 REVIEW (pages 207 &208) 1. What are the three parts that make-up a nucleotide? 2. Which of the following occur in the DNA replication process? (Circle the correct answer.) a. At the...
The process of making RNA using DNA as a template is called ___. The process of using the codes in RNA to make protein is called ___. Complete the following table with information on the three types of RNA polymerases and role of specific type of RNA in protein synthesis: In prokaryotes, the two stages of protein synthesis are: ___ and ___. In eukaryotes, the three stages of protein synthesis are ___, ___ and ___. During transcription, a ___ ___...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
1. The central dogma allows information flow in all of these directions EXCEPT (A) DNA to DNA (B) DNA to RNA (C) RNA to protein (D) Protein to DNA 2. The genetic code has all the following characteristics EXCEPT (A) The genetic code directs a specific amino acid to polypeptide (B) Five nucleotides comprise a codon (C) The genetic code is universal (D) The genetic code is conserved 3. Which description about restriction enzymes is true? (A) Recognize specific 4-8...
Which of the following is a chemical or structural characteristic of RNA? The RNA sugar is ribose, which has an OH group on the 2' carbon. O RNA is usually a single-stranded molecule. The bases in RNA include uracil instead of thymine. RNA molecules are generally shorter in length compared DNA macromolecules. All of the above are either a chemical or structural characteristic of RNA. Which of these sequences could form a hairpin? 5' GGGGTTTTCCCC 3' 5' AAAAAAAAAAAA 3' 5'...
Which best represents the flow of information in a cell (from recipe to function)? A Protein--RNA--DNA B RNA--DNA--Protein C DNA--RNA--Protein
Transcription is the process of rewriting DNA. DNA molecules are made from 4 different nucleotides which acts as building blocks. These building blocks are adenine, thymine, guanine and cytosine. When put together in different chemical combinations they become directions for the functions of the cell molecules which are primarily proteins. When a certain protein is needed, the RNA polymerase enzyme will find the gene for that particular protein and makes an RNA copy of it. DNA and RNA have similar...
pls fo all
20) A) an enzyme that synthesizes RNA as part of the transcription process B) an enzyme that uses RNA as a substrate C) an enzyme that catalyzes the association between the large and small ribosomal subunits D) an enzyme that synthesizes RNA primers during DNA replication E) an RNA with enzymatic activity 20) What is a ribozyme? 21) 21) Alternative RN A splicing A) increases the rate of transcription. B) can allow the production of similar proteins...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would be best described as... a. 3′- TACCTACG -5′. b. 5′- ATGGATGC -3′. c. 5′- AUGGAUGC -3′. d. 5′- UACCUACG -5′. e. 3′- UACCUACG -5′. Question 2b Which answer best summarizes how eukaryotic and bacterial RNA polymerases are different? a. Eukaryotes have several types of multimeric RNA polymerases, whereas bacteria only have one monomeric RNA polymerase. b. Eukaryotes have several types of RNA polymerases, one...