Homework Answers
Answer:
- It would be the D. First, we have to find the sequence complementary to the second oligonucleotide (as it is going the be the primer).
- But, we have to consider that it will join the large oligonucleotide in a different direction, for example the larger will go from 5´to 3´ and the primer will read from 3´ to 5´ because they are complementary (the complementary sequence of the primer is GACACT).
- Then we have to look for the nucleotides that would be added next to that primer and in a 5´ to 3´direction, those would be ATGGTA (the complementary sequence in the large oligonucleotide is TACCAT).
Please Rate My Answer...... Thank......u...
Add Answer to:
6. The two oligonucleotides below are allowed to anneal and a set of sequencing reactions are...
Question 2 Classical DNA sequencing is a powerful technique. Consider a situation where you first sequence...
Question 2
Classical DNA sequencing is a powerful technique. Consider a situation where you first sequence a normal strand of DNA, then sequence a mutated strand. When analysing the results of sequencing reactions, run on a gel, would you be able to distinguish each of the following mutation types, compared to unmutated sequence, using classic "Sanger" sequencing? A silent mutation An insertion of 6 nucleotides A sense mutation Which of the following factors directly breaks phosphodiester bonds? Select all that...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing....
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Pleaae answer this with explanation asap.I would really apprecuate it . 6. (4 points) Dideoxy sequencing...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
If you wish to sequence a long strand of DNA in one round of reactions, you...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
central dogma question The nucleotide sequence below is from an individual. Only one strand of the...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template")....
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...
looking for answers only questions #4 And #5 and #6 1 1 - + O Fit...
looking for answers only questions #4 And #5 and #6
1 1 - + O Fit to page Page View A Read aloud Add notes 6 8 % 1. Why do individuals have two copies of each STR region? (Hint: Humans have maternal and paternal chromosomes.) Below is a DNA profile of three individuals using two different STRs: AGGCT and CAATG ) The DNA profile below shows the band pallerns of three individuals that resulted from gel electrophoresis separating the...
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a....
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...
Question 2
Classical DNA sequencing is a powerful technique. Consider a situation where you first sequence a normal strand of DNA, then sequence a mutated strand. When analysing the results of sequencing reactions, run on a gel, would you be able to distinguish each of the following mutation types, compared to unmutated sequence, using classic "Sanger" sequencing? A silent mutation An insertion of 6 nucleotides A sense mutation Which of the following factors directly breaks phosphodiester bonds? Select all that...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...
looking for answers only questions #4 And #5 and #6
1 1 - + O Fit to page Page View A Read aloud Add notes 6 8 % 1. Why do individuals have two copies of each STR region? (Hint: Humans have maternal and paternal chromosomes.) Below is a DNA profile of three individuals using two different STRs: AGGCT and CAATG ) The DNA profile below shows the band pallerns of three individuals that resulted from gel electrophoresis separating the...
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...
Most questions answered within 3 hours.
-
For the movie my big fat greek wedding
1. Locate and describe three instances of non-verbal...
asked 3 minutes ago -
When a bank makes its loans, if it screens its borrowers it will
collect repayment revenue...
asked 1 minute ago -
A customer has requested that Lewelling Corporation fill a
special order for 2,400 units of product...
asked 24 minutes ago -
What are two strengths and two weaknesses of hardware,
software, and/or data?
How can the weaknesses...
asked 27 minutes ago -
A and B face the choice of working in a safe
mine at €200/wk or an...
asked 47 minutes ago -
True or false: couldnt figure out these few
- When charges are only located OUTSIDE an...
asked 55 minutes ago -
Given the following function:
int fun1(int count){
int Num ;
for (i = 0; i <...
asked 56 minutes ago -
Please submit your paper topic so that I can review it and make
any necessary suggestions...
asked 57 minutes ago -
Why are there so many theories of addiction? (Consider the
adequacy of each theory in relation...
asked 1 hour ago -
22mL of 0.1020M Naoh is used in a titration against an unknown
1M acid (30mL). Determine...
asked 1 hour ago -
Solve for distance using 90 db = 85 db + 20 log (20 ft/
distance)
1.8...
asked 1 hour ago -
Aluminum is cast in an insulating ceramic mold with no
superheat. The thickness of the casting...
asked 1 hour ago