Homework Answers
1. 6th nucleotide has changed from T to C. This will change the second codon from AAT to AAC. Correspondingly, the codon on messenger RNA will change from AAU to AAC. Both of these codons code for the amino acid asparagine.
Because the nucleotides is changed but the amino acid has not changed, this is a type of silent mutation.
2. There will be no effect on the structure and function of protein carrying this mutation. This is because the nucleotide has changed but the amino acid has not changed so the structure will remain the same.
Please rate high.
Add Answer to:
Course: EXERCISE 1 MUTATION or in a small group or alone to complete this exercise. In...
EXERCISE 1 MUTATION Work in a small group or alone to complete this exercise. In Lab...
EXERCISE 1 MUTATION Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the amino acid sequence for the following strand of DNA: AGCAATCCGTCTTGG TCGTTAGGCAGAACC That strand has mutated. It is now AGCAACCCGTCTTGG TCGTTGGGCAGA ACC Use your knowledge of mutation and protein synthesis to answer the following questions 1. What mutation has occurred? 2. Will this mutation have a real effect? Why or why not? (Hint: You may want to try Exercise...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
I have my own answers, i just want to check my work, thanks! Given the DNA...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single...
You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single mutation in the DNA that causes a change in the amino acid sequence to: N-MET-VAL-GLN-TRP-PRO-ASP-LEU-CYS-GLY-C. a) What kind of mutation is this? Explain. (2 points) b) Indicate the DNA sequence (coding strand) of the gene. Show the original DNA sequence then the mutated sequence. Wild type DNA: Mutant DNA: You have another mutation (a different mutation from the one described in parts a and...
Course: EXERCISE 1 BONE REMODELING Work in a small group or alone to complete this exercise...
Course: EXERCISE 1 BONE REMODELING Work in a small group or alone to complete this exercise 1. Describe one hypothetical situation that illustrates the use it portion of the use it or lose it principle. De- scription of the situation/behavior: Explanation for why more bone is present under these circumstances 2. Describe one hypothetical situation that illustrates the "lose it portion of the use it or lose it principle. De- scription of the situation/behavior: Explanation for why less bone is...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
Complete the following table and answer the next two questions (3.5 marts) 10 B I =...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
EXERCISE 1 MUTATION Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the amino acid sequence for the following strand of DNA: AGCAATCCGTCTTGG TCGTTAGGCAGAACC That strand has mutated. It is now AGCAACCCGTCTTGG TCGTTGGGCAGA ACC Use your knowledge of mutation and protein synthesis to answer the following questions 1. What mutation has occurred? 2. Will this mutation have a real effect? Why or why not? (Hint: You may want to try Exercise...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
Course: EXERCISE 1 BONE REMODELING Work in a small group or alone to complete this exercise 1. Describe one hypothetical situation that illustrates the use it portion of the use it or lose it principle. De- scription of the situation/behavior: Explanation for why more bone is present under these circumstances 2. Describe one hypothetical situation that illustrates the "lose it portion of the use it or lose it principle. De- scription of the situation/behavior: Explanation for why less bone is...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
Most questions answered within 3 hours.
-
You are a monopolist and know that your consumers have a linear
demand curve. At what...
asked 3 seconds ago -
Which of the following are true about the strength of the
association between two variables?
1-...
asked 1 minute ago -
Raising a heavy load requires work. Raising it in half the time
requires:
asked 6 minutes ago -
Calculate the number of valence electrons for
[Mo(C6H6)(CO)3]
asked 4 minutes ago -
MGT-201: Marketing Management
Before deciding on the structure of the channel marketers must
take several factors...
asked 6 minutes ago -
1. ACLs allow a router to control traffic within a network. The
concept is very similar...
asked 7 minutes ago -
35. When the electron in a hydrogen atom falls from its first
excited energy level to...
asked 9 minutes ago -
A man is dragging a box of mass "m" by using a rope which rests
on...
asked 25 minutes ago -
Liquid octane
(CH3(CH2)6CH3) will
react with gaseous oxygen (O2) to produce gaseous carbon
dioxide (CO2) and...
asked 27 minutes ago -
For the reaction N2(g) +
O2(g) --> 2NO(g), if the initial
concentration of NO was 0.00M...
asked 30 minutes ago -
On a recent quiz, the class mean was 75 with a standard
deviation of 2.2. Calculate...
asked 46 minutes ago -
Discuss the Coefficient of Restitution in an elastic collision
compared to the Coefficient of Restitution in...
asked 50 minutes ago