6a. What is the size of the uncut pKAN? __________________ What would this look like if you ran it on a gel? Explain.
6b. If you cut pKAN with one enzyme, how many fragments would you see if you ran the sample on gel electrophoresis. What size would the fragment(s) be?
6c. If you performed a double digest of pKAN with BamHI and HindIII, how many fragments would you see if you ran the sample on gel electrophoresis? What size would the fragment(s) be (indicate them from smallest to largest)?
6a) size of uncut plasmid will be less than 5.5kb which is actual size but due to circular in nature it actual size become less and band will form around 3kb
6b) pKAN size is 4194 kb which become linear after digesting with single enzyme
6c) if we digest pKAN by BamHI and HindIII then it will cut at 2095bp and 234bp from start position of plasmid then the fragment size will be 2095bp-234bp=1861bp
While remaining fragment of plasmid will be 4194-1861=2333bp
So on gel electrophoresis two fragments will be observed one 2333bp and another 1861bp.
Hope it's clear.. thanks
6a. What is the size of the uncut pKAN? __________________ What would this look like if...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
How did you EXPECT your uncut lane to look in the gel image?
What ACTUALLY happened? What is a plausible explanation if there
was any discrepancy?
How did the observed BclI and EcoRI digest results compare to
the expected results? If they differed, list a potential reason
why?
BclI was incubated at 50°C, while EcoRI was incubated at 37°C.
Why was this necessary? What might you predict to occur if you
accidentally switched the temperatures?
3) Using the DNA ladder,...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
If you stopped gel electrophoresis halfway during the running time, what would you expect? not all the fragments have separated from each other in the gel yet the smallest fragments will still be in the loading well of the gel the largest fragments will be at the opposite end of the gel
At the end of gel electrophoresis, what would you expect to find? the largest fragments closest to the wells O the mid-sized fragments toward the middle of the gel the smallest fragments toward the opposite end of the gel from the loading wells O all of the above
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...