Homework Answers
After analysing all the codones it is seen that the mutation have taken codon UUA which is responsible for the producing leucine in the cancer patient.But in normal individuals UUA is actually stands for a nonsence codon or stop codon.
So the mutation must have taken place in the UUA.
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
The following genomic DNA sequence comes from the first exon of a human gene and contains...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
base pairing Done stand is positively charged and th one strand contains only purind e DNA...
base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...
Most questions answered within 3 hours.
-
You have a yeast cell culture with a concentration of 5x10^4
cells/ml. If you dilute this...
asked 18 seconds ago -
In which direction the Reaction goes? Show detailed process.
SeO3 + 2ClO2. + 2H3O <---> Se...
asked 13 minutes ago -
Unexposed silver halides are removed from photographic film when
they react with sodium thiosulfate
(Na2S2O3, called...
asked 14 minutes ago -
A 0.3054 gram sample of the mineral chalcopyrite (CuFeS2)
yielded 0.6525 gram BaSO4 precipitate. What is...
asked 14 minutes ago -
An short-seller in Tesla is worried the latest management
earnings forecast is too aggressive and the...
asked 1 hour ago -
Question 3 (1 point)
Fill in the blank. Speed Car Rental company found that the tire...
asked 1 hour ago -
1. A copper wire is 26.61 cm long and weighs 1.265 g. The
density of copper...
asked 37 minutes ago -
Remember that a concept sketch consists of a sketch (or
series of sketches), labels, and complete...
asked 40 minutes ago -
on a newly discovered planet, the period of a pendulum with a
length of 2 m...
asked 42 minutes ago -
Why [M(CN)6] is not organometallic even it has metal
to carbon bond too
asked 48 minutes ago -
mstar electric has a bond issue outstanding that has a 20 year
life, a $1,000 par...
asked 56 minutes ago -
This is a Business Writing Question:
Common Types of Faulty Sentence Logic:
A. Mixed constructions
B....
asked 57 minutes ago