Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
Question 12
Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
Question 4
Match the nucleotide pictures to their names.
Homework Answers
Question 12.
Answer- A. silent mutation
Silent mutation does not have an observable effect on the phenotype of an organism.
Question 4.
Answer- A- adenine
B- Guanine
C-thymine
D- Cytosine
All these are bases that makeup nucleotide. a nucleotide is composed of base, sugar, and phosphate.
Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!
Add Answer to:
Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
D Question 4 A silent mutation has no change in RNA sequence O no change to...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a...
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a polypeptide even though the nucleotide sequence has been changed. Induced mutation Nonsense mutation Silent mutation Missense mutation None of the above 2 points QUESTION 50 Which of the following is an example of DNA damage? Loss of the helix structure of the DNA. A single break in the backbone...
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide...
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
A substitution mutation is one in which one nucleotide base is changed to another
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to...
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to an impaired protein function A Question Progress A B. All organisms have elaborate mechanisms to repair DNA damage C. DNA mutation is a temporary change in DNA sequence D. Environmental mutagens are safe and won't cause cancer E. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two totally different molecules of DNA Reset Selection
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to an impaired protein function A Question Progress A B. All organisms have elaborate mechanisms to repair DNA damage C. DNA mutation is a temporary change in DNA sequence D. Environmental mutagens are safe and won't cause cancer E. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two totally different molecules of DNA Reset Selection
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
Most questions answered within 3 hours.
-
Tennis champion Maria Sharapova is capable of serving a tennis
ball at 126 mph.
b) What...
asked 2 minutes ago -
The electric potential V in the space between the plates of a
given vacuum tube is...
asked 11 minutes ago -
The Hydroboration-Oxidation of an Alkene to Yield 1-Octanol.
1-octene to 1-octanol using BH3-THF
What might be...
asked 16 minutes ago -
You draw and keep a single bill from a hat that contains a
$11, $55, $20...
asked 33 minutes ago -
Write a Java program that has the following methods:
findSum - a method that takes in...
asked 34 minutes ago -
A coffee cup calorimeter initially contains 135g of water at
22.0oC. Calcium chloride (21.0g) at the...
asked 37 minutes ago -
A patient is having a magnetic resonance imaging scan (an MRI)
and has neglected to remove...
asked 39 minutes ago -
A student takes a multiple-choice test that has 10 questions.
Each question has two choices. The...
asked 1 hour ago -
Willie Keeler has a lifetime batting average of 0.341. Assume
that Willie Keeler came to bat...
asked 1 hour ago -
Which of the following has the highest boiling point?
A) 0.5m NaCl
B) 0.5m C6H12O6
C)...
asked 1 hour ago -
12. A firm is producing at an output level where
AR = MC > AC >...
asked 1 hour ago -
Radovilsky Manufacturing Company, in Hayward, California,
makes flashing lights for toys. The company operates its production...
asked 1 hour ago