Sketch these DNA models, recording the nucleotide sequence of the strands and labeling the 3’ and...

Question

Question

Sketch these DNA models, recording the nucleotide sequence of the strands and labeling the 3’ and 5’ ends of each.

Answer 1

Answer #1

Answer-

5'--ACTGACTGG--3'

3'--TGACTGACC--5'

Adenines are marked as orange

Cytosine are labeled as blue, Yellow is marked as Thymine and green indicate guanine.

Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!

Answer 2

Similar Homework Help Questions

A. Give the nucleotide sequence of the newly synthesized DNA strands B. Identify the leading and...

A. Give the nucleotide sequence of the newly synthesized DNA strands B. Identify the leading and lagging strand ehotooeeAAAAY AnoChronAAA?
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
How DNA Is Copied 4. What does it mean that the two strands of DNA are...

How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?

1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Cli...

If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Click in the answer box to activate the palette. 3- ATGGCCCATTACTTTCCCGTA -5' Only enter the letters representing the nucleotides.
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone...

a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...