How would having the reverse compliment of the sequence via sequencing with the ITS 1F primer...
How would having the reverse compliment of the sequence via sequencing with the ITS 1F primer help increase the quality of your final sequence?
Homework Answers
- The DNA strand is represented in the forward direction from 5' to 3'. The forward primer direction (5'-3') is called as the sense strand or a template DNA strand from of which replica is to be made.
- The reverse sequence starts in the reverse direction that is from 3'-5'
- If you just reverse the above strand sequence, then it will be in 3' to 5' direction and will you give a totally different amino acid sequence. Whereas, if you reverse complement the above forward strand sequence then you will the same peptide sequence as needed.
- If we now start translating the above sequences we will get a complete amino acid sequence.
Add Answer to:
How would having the reverse compliment of the sequence
via sequencing with the ITS 1F primer...
The following primer sequence was used in a Sanger sequencing reaction along with the following template,...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
pls help ? Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3)...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator...
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5’-----------3’ of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or T nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. A C G T L
based on the given graph how would these be answered? sa sequence from a sheep PCR...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
Help SEVES E Sube 4 A short sequence read is shown below. The primer used was...
Help SEVES E Sube 4 A short sequence read is shown below. The primer used was 5 GGAACGCCCATATCCCGCGG. (A=red C=green: G=purple: T - black.) How would the dela look If you accidentally omitted the deoxyTIP (DTTP) from the sequencing reaction? 20 paints 800-21:55 Lager — Smaller Multiple Choice 0 The black peaks would be missing and the positions of the other peaks would shift so that there would be no spaces. 0 The red peaks would be missing and the...
How do I calculate the approximate melting/annealing temperature of a primer containing this sequence (which anneals...
How do I calculate the approximate melting/annealing temperature of a primer containing this sequence (which anneals perfectly to its target): 5' GAT TTA CCG TAC TGG GCA ACG 3' More importantly than the actual Tm, I would like to understand HOW to get to there. Thanks!!!
1.) How many kinds of reverse transcriptases are there ? 2.) What would normally be a...
1.) How many kinds of reverse transcriptases are there ? 2.) What would normally be a proper order to assemble yout RT reaction mix ? Your PCR mix ? Why is the order important ? 3.) Why do you need many PCR cycles to see reaction products ? 4.) Why are multiple product bands sometimes seen during PCR reactions ? How can this problem be minimized ? 5.) Betaine is often included in transcription reactions. What is betaine ? What...
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Question 9. (a) Which parties are impacted by reverse mortgages marketing strategies? (b) If you are a bank hoping to increase profits, would you try to expand your marketing of reverse mortgages to s...
Question 9. (a) Which parties are impacted by reverse mortgages marketing strategies? (b) If you are a bank hoping to increase profits, would you try to expand your marketing of reverse mortgages to seniors? (c) If you are a marketing manager at a bank that has made the strategic decision to grow its reverse mortgage business, how would you go about promoting the product?
An F' plasmid from an exotic marine bacterium that can degrade petroleum when mated with an...
An F' plasmid from an exotic marine bacterium that can degrade petroleum when mated with an F-E. coli that cannot degrade petroleum results in an E. coli F' that can degrade petroleum. After sequencing the F' plasmid and comparing it to the F sequence, you see that it has about 6000 base pairs of additional DNA. You suspect that there is a gene in that sequence that encodes a protein that degrades petroleum. Describe how you would use reverse genetics...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
Help SEVES E Sube 4 A short sequence read is shown below. The primer used was 5 GGAACGCCCATATCCCGCGG. (A=red C=green: G=purple: T - black.) How would the dela look If you accidentally omitted the deoxyTIP (DTTP) from the sequencing reaction? 20 paints 800-21:55 Lager — Smaller Multiple Choice 0 The black peaks would be missing and the positions of the other peaks would shift so that there would be no spaces. 0 The red peaks would be missing and the...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Most questions answered within 3 hours.
-
Write the ionic equations for the first stage of salts
hydrolysis.
Anion, Cation?
Na2S
NiSO4
K2SO4...
asked 38 minutes ago -
suppose there is a normally distributed population with a mean of
250 and a standard deviation...
asked 1 hour ago -
Question Three
Suppose you as project manager are using the Waterfall
development methodology on a large...
asked 2 hours ago -
Which statement is not true about welfare in Canada?
A.Benefits typically vary based on one's ability...
asked 2 hours ago -
Please help me with FLOWCHART and UML diagram for class,
thank you!
#include <iostream>
#include <fstream>...
asked 3 hours ago -
3. Describe the “logic circuit” of the Lac operon. Which
proteins are bound or not to...
asked 3 hours ago -
Ayesha’s adjusted gross income is $60,000 in 2019. She donated a
piece of artwork with a...
asked 3 hours ago -
For Dijkstra’s shortest path algorithm:
a. Give the Big-O time for Dijkstra’s shortest path algorithm
and...
asked 3 hours ago -
Phosphorus violates the 'octet rule' in biological molecules,
forming more covalent bonds than expected based on...
asked 4 hours ago -
A 1.3 eV electron has a 10-4 probability of tunneling
through a 2.4 eV potential barrier....
asked 4 hours ago -
What is the one ingredient that is common to being successful
with all stakeholders?
profit
trust...
asked 4 hours ago -
Write an assembly language 32 bit program that reads in lines of
text by a .txt...
asked 4 hours ago