You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator...
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5’-----------3’ of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or T nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel.
A C G T L
Homework Answers
Add Answer to:
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3)
with a reverse primer (5-CGCTTAACC-3) with radioactive labeled
chain terminator...
pls help ? Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3)...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse...
Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse primer with this sequence ´5-CGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA-3´
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
If you wish to sequence a long strand of DNA in one round of reactions, you...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
please help me with both of these questions!!!! 3:33 PM Wed Mar 18 Enter answer... 5:06...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
We understand that your diagram will not be able to portray the bands to their exact base-pair si...
We understand that your diagram will not be able to portray the bands to their exact base-pair size, and that in some cases you may not be able to calculate an exact size for your bands. Just do your best in terms of positioning the bands in the lanes with respect to the standard markers, but please do not panic if the bands are a couple of mm away from perfect in your diagram. LABEL each band with its size...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
We understand that your diagram will not be able to portray the bands to their exact base-pair size, and that in some cases you may not be able to calculate an exact size for your bands. Just do your best in terms of positioning the bands in the lanes with respect to the standard markers, but please do not panic if the bands are a couple of mm away from perfect in your diagram. LABEL each band with its size...
Most questions answered within 3 hours.
-
This java code won't run and I can't figure out the problem with
it. Please help...
asked 48 minutes ago -
Trace the following recursive methods:
a) isPal with the string “abccda”
b) isAnBn with the string...
asked 1 hour ago -
1. Which of the following is false about photosynthesis?
A. ATP is the molecule used to...
asked 2 hours ago -
A simple random sample of size n=64 is obtained from a
population with a mean of...
asked 3 hours ago -
(2 dimensions, 1 object, 2 accelerations)
1) A projectile is thrown with a wind. The wind...
asked 4 hours ago -
Brian makes $34,100 per year. How much can Brian expect to
contribute to FICA taxes in...
asked 5 hours ago -
To buy a new house you must borrow $155,000. To do this you take
out a...
asked 5 hours ago -
Spacely Sprockets is evaluating the construction of a new plant
on land the company purchased for...
asked 6 hours ago -
1. Consider a linear regression model of y on K regressors and
an intercept.
(i) Describe...
asked 6 hours ago -
Enter a balanced equation for the reaction between hydrochloric
acid and sodium sulfite.
Express your answer...
asked 6 hours ago -
Give a regular expression describing the language
{x | x ∈ Σ* and x does not...
asked 6 hours ago -
Masses of 1.0 kg, 2.0 kg, and 3.0 kg are each separately subject
to a net...
asked 6 hours ago