Describe one mechanism by which double stranded RNAs can reduce or eliminate the production of protein...
Describe one mechanism by which double stranded RNAs can reduce or eliminate the production of protein from a particular gene.
Homework Answers
Best example is siRNA which is short double stranded RNA. It break into single strand and this single strand bind with that gene whose protein synthesis have to be inhibited.
So that mRNA become double stranded so degrades and no synthesis of protein occur.
Add Answer to:
Describe one mechanism by which double stranded
RNAs can reduce or eliminate the production of protein...
Double-stranded RNAs are processed by the enzyme _______ to form small interfering RNAs (siRNAs). One strand...
Double-stranded RNAs are processed by the enzyme _______ to form small interfering RNAs (siRNAs). One strand of the siRNA is loaded into a silencing complex named _________. The siRNAs target mRNA for ___________ . A. Dicer, RISC, degradation B. RISC, Dicer, spicing C. RISC, Dicer, degradation D. Dicer, RISC, splicing
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double...
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD
The following double stranded segment of DNA is part of a protein coding gene. The segments...
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
Suppose you are working on a gene that encodes a protein that triggers apoptosis of the...
Suppose you are working on a gene that encodes a protein that triggers apoptosis of the cell (programmed cell death). In a certain cell, this gene is transcriptionally ON, that is, primary transcript is being made. Choose a mechanism by which to prevent or reduce the production of active apoptosis protein, and describe the specific properties of the new regulatory protein that the cell would have to make in order to do this.
21. Double helix 22. Repressor protein 23. Adenine 24. Ribosome.
21. Double helix22. Repressor protein23. Adenine24. Ribosome.25. Promoter26. Replication27. RNA Polymerase.28. CodonA. Enzyme that synthesizes RNAB. Organelle where proteins are assembledC. Complementary to either Thymine or UracilD. mRNA sequence that codes for one amino acidE. Shape of double stranded DNAF. Sequence of DNA that controls gene expressionG. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in 5 phase of Interphase
Which of the following is NOT one of the primary ways a company can reduce its...
Which of the following is NOT one of the primary ways a company can reduce its investment in inventory? eliminate bottlenecks in the production process find more reliable suppliers forecast sales more accurately add new product lines
Please choose from this list to fill in the blanks below. Some choices can be used more...
Please choose from this list to fill in the blanks below. Some choices can be used more than once or not at all. Choices: rRNA, tRNA, miRNA, mRNA Typically forms internal base pairs to form a “cloverleaf” structure _________________ The primary transcript is larger than the final, mature form _____________________ Associates with proteins to form the ribosome ________________________ Drosha is needed to process this form of RNA ______________________ Contains protein-coding regions _________________________ This form of RNA contains the largest variety of nucleotide modifications ________________...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Mutations in the Rb gene are often associated with cancer. Draw or describe the mechanism/pathway by...
Mutations in the Rb gene are often associated with cancer. Draw or describe the mechanism/pathway by which a nonfunctional Rb protein can lead to cancer.
answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of...
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...
Most questions answered within 3 hours.
-
Which of the following is NOT a specific target of
antimicrobials and antibiotics?
A)Cell wall
B)Cell...
asked 12 minutes ago -
Which of the following models would provide the fastest
determination of the access cotrol privilege for...
asked 12 seconds from now -
In New England, the horizontal component of the Earth's magnetic
field has a magnitude of 2.5...
asked 7 minutes ago -
In a test of hypothesis Ho: P = .31 versus Ha: P > .31 at the...
asked 14 minutes ago -
Vertical Analysis of Balance Sheet
Balance sheet data for Alvarez Company on December 31, the end...
asked 30 minutes ago -
A rubber ball with a mass of 0.155 kg is dropped from rest. From
what height...
asked 38 minutes ago -
Describe how bacteria reproduce and provide a drawing
asked 48 minutes ago -
Does anyone know R studio>>>??????
Question 12 pts
Which code below will generate the output [1]...
asked 54 minutes ago -
5. A student
performs three runs of the experiment using the same unknown as
yours and...
asked 55 minutes ago -
The probability that a circuit board coming off an assembly line
needs rework is 0.1. Suppose...
asked 1 hour ago -
From the list below clasify if it is acid or basic and
the color of each...
asked 1 hour ago -
A 1.80-kg falcon catches a 0.650-kg dove from behind in midair.
What is their velocity after...
asked 1 hour ago