Ans. Each codon of mRNA specifies the generation of amino acid. Codon is a triplet of bases. mRNA forms during transcription will undergo translation process for the formation of protein which is made up of amino acid chain. The conversation of codon in mRNA to amino acid is conducted by transfer RNA or tRNA. Most amino acid are coded by more than one codon. Transfer RNA has an anticodon which will pair up with the codon of mRNA and lead to formation of chain of amino acids.
The ACC codon is for amino acid threonine and GGC codon is for amino acid glycine.
the codon on MRNA goes like this ACC|GGC what Amino acids are coded for by the...
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded by the DNA? Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...
What amino acid is coded for by each of the following mRNA codons? (Put the three letter abbreviation.) (a) CGA (b) GUG (c) CAA (d) CCU
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
EXERCISE Translation What two amino acids have only one codon? Enter their 3 letter abbreviations 2nd Mueles de Phe UUU UUC UUA UU Cys ucu UCC UCA UCO UGU UGC UAU UAC WA UA Stop dodon Stop codoh UOO Stop dod TEP CGU Ang CUU CUC CUA CU не His Oin Ag CAU CAC CAA CAC 3 15 Nuolatida COA COG din AUU AUC AUA AUG Initiation Codon ACU ACC ACA Асе UGAGUC6UcAGUCA Nucleotide AAC AAA AAO AGU AOC AGA...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
1. Five different bases and codon length of one results in a maximum of 5 codons, and five different bases and codon length of two results in a maximum of 25 codons. Which mathematical formula represents the relationship between the number of bases, codon length, and number of codons possible? (number of bases = n codon length = L) number of codons: ___________ 2. Calculate the minimum codon length needed to define four amino acids. With five bases, what is...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid: