We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Which of the following chemical modifications leads to condensation of chromatin and therefore reduces levels of...
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hint(s) Acetylation of histone tails is a reversible process Some forms of chromatin modification can be passed on to future generations of cells. DNA is not transcribed when chromatin is packaged tightly in a condensed form. O Acetylation of histone tails in chromatin allows access to DNA for transcription. Deacetylation...
Which statements about the modification of chromatin structure in eukaryotes are true? 1.DNA is not transcribed when chromatin is packaged tightly in a condensed form 2.Some forms of chromatin modification can be passed on to future generations of cells 3.Acetylation of histone tails in chromatin allows access to DNA for transcription 4.Acetylation of histone tails is a reversible process. 5. Methylation of histone tails in chromatin can promote condensation of the chromatin 6. Deacetylation of histone tails in chromatin loosens...
2. Describe condensation, including where, when and how it occurs. (Your answer should include gene, chromatin, chromosome, interphase, mitotic phase, gene inactivation, chromatin remodeling, histone covalent modifications, inheritance, methylation, acetylation, phosphorylation).
Which statements about the modification of chromatin structure in eukaryotes are true? 2 pts a. Acetylation of histone tails in chromatin allows access to DNA for transcription. b. Histone proteins are always permanently placed along a DNA sequence but the binding to DNA can be loosened. c. Methylation of DNA is associated with the gene activation. d. Acetylation of histone tails is a reversible process. e. Some forms of chromatin modification can be passed on to future generations of cells.
Which of the following histone modifications generally PREVENTS transcription from occurring? Methylation o acetylation Demethylation Phosphorylation
Which of the following statements about chromatin remodeling is incorrect? Select one: O a. Chromatin remodeling provides the transcription machinery with dynamic access to an otherwise tightly packaged genome. O b. Chromatin remodeling often involves histone modifications (e.g., methylation). O c. Eukaryotes use chromatin remodeling as a mechanism for epigenetic modifications. O d. Prokaryotes use chromatin remodeling to regulate operon activity. O e. Chromatin remodeling plays a central role in the regulation of gene expression.
Which of the following hypothesizes that the physical and functional status of a certain region of genomic chromatin is dependent upon the patterns of specific histone posttranslational modifications and/or DNA methylation status? a. PTM hypothesis b. Nuclear body hypothesis c. Epigenetic code d. Genetic code
Which statement is true with respect to eukaryotic chromatin? A> histone post-translational modifications are lost b>None of the the other selections are true statements c> Euchromatin represents regions with hypoacetylation of histones that leads to densely packed nucleosomes and promotes transcription D> Euchromatin represents regions with hyperacetylation of histones that leads to loosely packed nucleosomes and promotes transcription
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Which of the following are methods employed by cells to control gene expression? (hint: select all options that apply) Multiple answers: You can select more than one option O A Chromatin remodeling B Histone acetylation O c DNA methylation