Packaging of DNA into chromosomes --
In G0 and interphase stage of a cell , DNA exists as a nucleoprotein complex called chromatin , during M- phase chromatin is converted into more condensed form termed as chromosomes.Each chromosomes in anaphase stage of cell cycle consists of a single , enormously long linear DNA molecule associated with proteins that fold and pack the fine DNA thread into more compact structure.
Histone modification --
ALL of the histone protein are chemically modified , chemical modification of histones are associated with structural changes that occur at the time of replication and transcription. There are at least 8 distinct types of modifications found on histones [ such as acetylation, methylation, phosphorylation, sumoylation , ubiquitylation, ADP ribosylation ] . Three most common types of chemical modifications are -
1. Acetylation - each of the histone proteins making up the nucleosome core contains a flexible amino terminus of 11-37 extending from the fixed structure of the nucleosomes.These N- termini are called histone tails . acetyl groups are added to the lysine amino acids in the histone tail of each of the core molecules . enzymes that acetylate histones are called histone acety transferases.
2. Methylation - Many lysine and arginine amino acids at the N - terminus of histone undergo methylation. methylation at lysine or arginines may be one of three different forms; mono , di or trimethyl for lysines and mono - or di for arginine , it is catalysed by methyl transferase.
3. Phosphorylation - Although information about phosphorylation is limited however it is clear that they too can influence chromatin structure and have a significant impact on cellular activity . example- phosphorylation of histone H3 and H1 has been associated with the formation of metaphase chromosomes.
2. Describe condensation, including where, when and how it occurs. (Your answer should include gene, chromatin,...
1. One way that gene expression is regulated is in the remodeling of chromatin. Describe the three mechanisms of changes in the structure of the nucleosome as well as the effect of acetylation and methylation on gene expression? 2. Describe the impact of deletion, duplication, inversion and translocation on chromosome structure and gene expression of those chromosomes? 3. Explain how ATP is produced in respiration? Please help with this picture below as well! It’s a gram positive and negative bacteria.
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Describe 2 aspects of chromatin organised in the interphase nucleus and how does a gene change its position within a territory when it becomes transcriptionally active?
Name: 2. You cell cycle. Describe this process, including DNA replication (when is occurs and what is produced), The major portions of the cell cycle and what those portions are divided into. For the cell division process you should use a chromosome number of 2N-4, instead of the real human chromosome number of 2N-46 have a broken leg and you realize that in order to heal your body needs to proceed through the Name: 2. You cell cycle. Describe this...
Describe how a goiter might develop. Include in your answer what a goiter is and where, in the world, it would be most likely to occur in general
answer all the questions please *3 2 1 OA- АаВЬСcl AaBbc | АаВЬСc| АаВЬС Emphasis Heading 1 1 Normal Strong Paragraph ly Styles 8) In mammalian female cells, the DNA of the Barr Body is characteristic of a) Heterochromatin b) Euchromatin c) Dispersed chromatin d) Paternal DNA ONLY e) Maternal DNA ONLY 9) When used to describe the RNA polymerases' activity, the term "processivity” refers to: a) The ability to recognize and bind to a promoter region b) The ability...
answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
please help and thank you Materials Needed per class: 1 box of 24 microscope slides of meiosis 1 1 box of 24 microscope slides of meiosis 2 red and yellow popbead chromosome kits Objectives To become familiar with the process of meiosis and to be able to identify the principal phases of meiosis To understand how the process of meiosis is similar to mitosis and how it differs from mitosis Introduction The genetic information of a cell is encoded in...
PLEASE INCLUDE THE LETTER ANSWER WITH THE EXPLANATION 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Where in a mitochondrion is the proton gradient the smallest? o é o Across the outer mitochondrial membrane At the tips of the cristae furthest from the outer mitochondrial membrane At those parts of the cristae that are closest to the outer mitochondrial membrane There are no proton gradients in a mitochondrion Between the thylakoid lumen and the matrix o o The...
9-6 M. A. Merritt, 2016 1511 Lab Exercise #9 PROCEDURE 2: Simulation of the stages of Meiosis 1) To simulate synapsis, take the two homologous pairs of lona chromosomos and place one on top of the other. Do the same with the #2, medium length chromosomes and then the # 3 , short chromosomes., Fill in the sketch for PROPHASE 1 below, illustrating synapsis. Even though crossing over occurs in nature, DO NOT add CROSSING OVER to your sketch. After...