Using the genetic code complete the table below:
Using the genetic code complete the table below:
Complete the following table:
Homework Answers
Answer –
|
DNA non-coding strand |
ATG-GTT-CTA |
ACG-GAA-CGA |
TGT-TGG-TGA |
GGG-GGA-GGT |
|
DNA coding strand |
TAC-CAA-GAT |
TGC-CTT-GCT |
ACA-ACC-ACT |
CCC-CCT-CCA |
|
mRNA-sequence |
UAC-CAA-GAU |
UGC-CUU-GCU |
ACA-ACC-ACU |
CCC-CCU-CCA |
|
Amino acid sequence |
Tyr- Gln- Asp |
Cys-Leu-Ala |
Thr- Thr- Thr |
Pro- Pro- Pro |
Explanation -
Coding DNA strand also known as sense strand is the DNA strand which corresponds to mRNA sequence while non-coding strand also known as template strand is the DNA strand that undergoes transcription generating mRNA. The only difference between mRNA and coding strand sequence is presence of thymine instead of uracil in coding DNA strand compare to mRNA while mRNA sequence is complementary to non-coding DNA strand.
Thu with non-coding template strand DNA sequence
ATG-GTT-CTA- ACG-GAA-CGA- TGT-TGG-TGA- GGG-GGA-GGT
mRNA with the following sequence can be generated
UAC-CAA-GAU-UGC-CUU-GCU-ACA-ACC-ACU-CCC-CCU-CCA
Thus, the coding strand DNA sequence that could be complementary to non-coding strand but correspond to mRNA with instead of U, there would be T is
TAC-CAA-GAT-TGC-CTT-GCT-ACA-ACC-ACT-CCC-CCT-CCA
And lastly from mRNA sequence following amino-acid sequence generated
UAC-CAA-GAU-UGC-CUU-GCU-ACA-ACC-ACU-CCC-CCU-CCA
Tyr- Gln- Asp- Cys- Leu- Ala- Thr-Thr- Thr- Pro -Pro -Pro
Hence, the table is
|
DNA non-coding strand |
ATG-GTT-CTA |
ACG-GAA-CGA |
TGT-TGG-TGA |
GGG-GGA-GGT |
|
DNA coding strand |
TAC-CAA-GAT |
TGC-CTT-GCT |
ACA-ACC-ACT |
CCC-CCT-CCA |
|
mRNA-sequence |
UAC-CAA-GAU |
UGC-CUU-GCU |
ACA-ACC-ACU |
CCC-CCU-CCA |
|
Amino acid sequence |
Tyr- Gln- Asp |
Cys-Leu-Ala |
Thr- Thr- Thr |
Pro- Pro- Pro |
3. The mRNA base sequence below codes for part of a protein. Using the genetic code...
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
ARNA 11. Using genetic code table-list the corresponding aminoacids for triplet code: CAG, GAG, CAC, AUA,...
ARNA 11. Using genetic code table-list the corresponding aminoacids for triplet code: CAG, GAG, CAC, AUA, GUA, GCA and UGA, UAA and UAG 12. How many start and stop codons are there? 13. If the DNA single strand is AATTGGCCCGTAT, the what will be the complementary second strand of DNA ? 14. If the DNA single strand is AATTGGCCCGTAT, the what complementary RNA strand will be synthesized?
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below...
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below using the single letter amino acid abbreviation. 3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to...
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
Using the standard genetic code, find and translate an open reading frame that begins with a...
Using the standard genetic code, find and translate an open reading frame that begins with a start-codon and ends with a stop-codon in the following DNA sequence: ACCCATGGACTTTCAGTGAAAC
answer in c++ Using the table below, complete the C++ code to write the function prototype...
answer in c++ Using the table below, complete the C++ code to write the function prototype statement, and the void function header. The void function should receive three double variables: the first two by value and the last one by reference. Name the formal parameters num1, num2 and answer. The function should divide the num1 variable by the num2 variable and then store the result in the answer variable. Name the function calcQuotient. Also write an appropriate function prototype for...
The genetic code is considered degenerate because most amino acids are encoded by at least two...
The genetic code is considered degenerate because most amino acids are encoded by at least two different codons. Some researchers have hypothesized that during evolution the genetic code has been optimized for its intended use in different organisms. Reseachers can study this by examining the relationship between the frequency with which an amino acid appears in all the proteins in an organism and the total number of codons for an amino acid. An optimized organism would use amino acids in...
Is the genetic code universal? State YES or NO. What is the significance of the genetic...
Is the genetic code universal? State YES or NO. What is the significance of the genetic code?
Instruction: Answer the following Using below half-cut flowchart, write a complete source code using while repetition...
Instruction: Answer the following Using below half-cut flowchart, write a complete source code using while repetition structures. count = 0; false (count <100) true cout << "Welcome to C++": count:
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
ARNA 11. Using genetic code table-list the corresponding aminoacids for triplet code: CAG, GAG, CAC, AUA, GUA, GCA and UGA, UAA and UAG 12. How many start and stop codons are there? 13. If the DNA single strand is AATTGGCCCGTAT, the what will be the complementary second strand of DNA ? 14. If the DNA single strand is AATTGGCCCGTAT, the what complementary RNA strand will be synthesized?
The genetic code is considered degenerate because most amino acids are encoded by at least two different codons. Some researchers have hypothesized that during evolution the genetic code has been optimized for its intended use in different organisms. Reseachers can study this by examining the relationship between the frequency with which an amino acid appears in all the proteins in an organism and the total number of codons for an amino acid. An optimized organism would use amino acids in...
Instruction: Answer the following Using below half-cut flowchart, write a complete source code using while repetition structures. count = 0; false (count <100) true cout << "Welcome to C++": count:
Most questions answered within 3 hours.
-
Considering gravitational time dilation, calculate the time that
passes in Earth’s surface while 1 hour passes...
asked 4 minutes ago -
Minitab Problem: Take the Lake Hume June rainfall data and find
use the processes outlined in...
asked 56 minutes ago -
X Company is trying to decide whether to continue using old
equipment to make Product A...
asked 57 minutes ago -
IN PYTHON ONLY !! Program 2: Re-work
program #5 (WeeklyHours) from the previous assignment such that...
asked 1 hour ago -
The average length of time between arrivals at a turnpike
toll-booth is 26 seconds. What is...
asked 3 hours ago -
(a) A piston at 6.1 atm contains a gas that occupies a volume of
3.5 L....
asked 4 hours ago -
Please answer true or false. Words
cannot be changed or added in to make it true...
asked 4 hours ago -
An empty test tube weighs 15.923 grams. Then,
MgCl2•6H2O is added into the test tube. After...
asked 4 hours ago -
Assume memory access is 10 units of time and disk access is
10000 units of time....
asked 4 hours ago -
1. Are all good samples random?
2. Magazines often report surveys giving statistics such as “63%...
asked 5 hours ago -
Under all the various types of market structures, firms
must eventually earn some economic profits for...
asked 4 hours ago -
Consider the following fitness regime for a single locus trait
with two co-dominant alleles: w11 =...
asked 4 hours ago