Using the standard genetic code, find and translate an open reading frame that begins with a...
Using the standard genetic code, find and translate an open reading frame that begins with a start-codon and ends with a stop-codon in the following DNA sequence: ACCCATGGACTTTCAGTGAAAC
Homework Answers
the open reading fram starts with a start codon and stop with a stop codon.
one open reading frame in the sequence is given in bold
ACCCATGGACTTTCAGTGAAAC
the amino acid sequence translated is
Met-Asp-Phe-Gln
Add Answer to:
Using the standard genetic code, find and translate an open
reading frame that begins with a...
3. Translation. According to the rules of the genetic code, there are six different reading frames...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
7. Open reading frames A protein coding gene includes the following sequence on one of its...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode...
A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. Genetic Code 5 CCATGCACCAGATCGCTTATTAAAT 3 Codon ATG TAA TAG TGA Amino Acid Met - Start Stop Stop Stop Number
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then...
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene in the spaces provided below. 5' ATGGGAGCTGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5' Transcribe mRNA sequence and translated protein sequence.
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
Which of the following are usually located in the "open reading frame" of a gene (CHeck...
Which of the following are usually located in the "open reading frame" of a gene (CHeck all that apply) exons promoter start codon 5'-UTR introns polyadenylation signal a frameshift mutation 3'-UTR
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below...
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below using the single letter amino acid abbreviation. 3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2...
Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2 The correct answer is B because there is the largest distance between the start codon and stop codon. I get that. What I don't get is that these strands are written from 5' to 3'. I know that this is the convention, but I thought that DNA was read from 3' to 5' by the enzymes that synthesize the new strand? What am I...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. Genetic Code 5 CCATGCACCAGATCGCTTATTAAAT 3 Codon ATG TAA TAG TGA Amino Acid Met - Start Stop Stop Stop Number
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
Most questions answered within 3 hours.
-
The size of a movement ALONG a demand curve caused by a shift in
supply would...
asked 6 minutes ago -
Neal Nicely was driving on the parkway when he noticed two little
2. old ladies on...
asked 10 minutes ago -
1/Do you know how stem cells are retrieved ?
2 Does a zygote ( early fetus)...
asked 22 minutes ago -
A 2500 kg satellite is flying through empty space at speed vi =
20km/s. Find the...
asked 23 minutes ago -
Describe the four stages of extravasation
Describe the function of neutrophils
Compare innate and adaptive immunity...
asked 26 minutes ago -
A roads department wants to capitalize annual maintenance fees
of $5 million. It applies to the...
asked 30 minutes ago -
Question 6 (1 point) Landmark Coal operates a mine. During July,
the company obtained 500 tons...
asked 34 minutes ago -
A 4.0 cm -tall object is 10 cm in front of a converging lens
that has...
asked 33 minutes ago -
Chase is currently trading at $66.02. Analysts predict that
there is a 20 % probability that...
asked 46 minutes ago -
Calculate the amount of heat needed to boil 120.g of
acetic acid (HCH3CO2), beginning from a temperature...
asked 54 minutes ago -
What conservation laws are involved in the computation
of the initial velocity of a projectile using...
asked 1 hour ago -
Suppose that the following is an internal node of a B+ tree.
Which pointer is the...
asked 1 hour ago