Is the genetic code universal? State YES or NO. What is the significance of the genetic code?
Is the genetic code universal? State YES or NO. What is the significance of the genetic...
1. Anticodon: 3' U A I 5' Could this tRNA conform to the nearly universal genetic code? Yes or no
3. Since the genetic code is universal*, different organisms will all “read (transcribe + translate)” the same gene sequence the same way. Recombinant DNA technology takes advantage of this by artificially transferring DNA from one organism to another. Give one example of this that would be useful (could be for medicinal purposes, industry, agriculture, etc.)
2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
60. _A_The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61. Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E. Spliceosomes,...
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have a 3' untranslated region? Where is it in the sequence? This sequence is the coding strand. 1st bracket = promoter, 2nd bracket = 5' untranslated region [ ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG
pour Paragraph 60. The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61.__Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E....
The genetic code comes in the form of triplets called Through testing it was discovered that the come had degeneracy (a.k.a. could all produce the same amino acid. But the opposite is not true, each that each spell out one amino acid. ) that meant several triplets triplet only ever encodes or spells one amino acid. This property is called . Lastly, the code has start and stop triplets and is nearly universal.
Suppose there were a genetic defect in the genes that code for kinesins and dyneins. What would happen within the cell? why?
Explain the "Genetic Code." What is it? How is it similar amongst all living things? What does this mean as far as the development of life on Earth?