Which of the following are macromolecules composed of one or more polypeptides covalently linked by peptide...
Which of the following are macromolecules composed of one or more polypeptides covalently linked by peptide bonds?
Select one or more:
Cellulose
Casein
Amylase
peroxidase
dextran
Gelatin
Homework Answers
Add Answer to:
Which of the following are macromolecules composed of one or
more polypeptides covalently linked by peptide...
Proteins that are composed of two or more subunits or polypeptides are said the have quanternary...
Proteins that are composed of two or more subunits or polypeptides are said the have quanternary structure. Select one: True False
A(n) __________ is composed of one or more polypeptides and some nonprotein component. Group of answer...
A(n) __________ is composed of one or more polypeptides and some nonprotein component. Group of answer choices conenzyme substrate cofactor holoenzyme apoenzyme
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more:...
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more: a. atgtaacagcatccagaaaaaaagtattga O b. atgtcccaacatgataagaacttcaaccat □ catgagccaggcagttatagaaaaaccgcat datgagccagcataacgaaaaaaacccgcat
Which of the following is a key difference between primary and secondary immunofluorescence? Select one: a....
Which of the following is a key difference between primary and secondary immunofluorescence? Select one: a. Primary immunofluorescence (but not secondary) uses a form of light microscopy to excite the fluorophore b. More than one of the listed characteristics are key differences between primary and secondary immunofluorescence c. Secondary immunofluoresence (but not primary immunofluorescence) is used when more than one antigen needs to be stained d. In primary immunofluorescence the antibody that recognizes the epitope of the antigen is also...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Which of the following is correct concerning a peptide backbone? Choose one: O A. The peptide...
Which of the following is correct concerning a peptide backbone? Choose one: O A. The peptide bond allows for free rotation due to its single bond character. OB. A Ramachandran plot shows the allowable and V angles for a peptide. O C. The torsional angle between the Ca and the Rgroup is called “ (phi). O D. The torsional angle between the amide nitrogen and the Ca is called (psi).
Are these answers correct? For the following list of peptides, predict which peptide would elute...
Are these answers correct?
For the following list of peptides, predict which peptide would elute from the column first. Note that all conditions below are based on the fact that the separation is being performed at pH 7. Peptide Name Sequence AGVILPVYATIGSGIVNPAFPVVSLEVVLER GTADVTPDLEEMK QPILIAVVLOLSQQLSGINAVFYYSTSIFEK LMLAVGGAVLGSLQFGYNTGVİ NAPOK VTILELFR Not changed since last attempt Marked out of 2.00 Question 5 Which peptide would elute last from a column that separates ONLY on hydrophobicity? Select one: Not changed since last attempt Marked...
Which if the following compounds contains one or more covalent bonds? Select one: a. CO2 b....
Which if the following compounds contains one or more covalent bonds? Select one: a. CO2 b. CaS c. Na2O d. KCl e. CaCl2
1. Given the following peptide, which of the following statements is true? Question options: a) The...
1. Given the following peptide, which of the following
statements is true?
Question options:
a) The N-terminal residue is leucine.
b)This peptide contains 4 amino acid residues.
c) The peptide contains a total of 6 ionizable groups.
d) The net charge of this peptide at pH 7 is +1 Locate any
peptide bond along the backbone of the given peptide.
e) The bond between the C (of the C=O) and the N (of the N-H) of
a peptide bond has...
1. Which of the following is not one of the four(4) macromolecules.
1. Which of the following is not one of the four(4) macromolecules.a. Carbohydratesb. Lipidsc. Nudelc acidsd. Nope of the above2. A common characteristic of organic molecules versus inorganic molecules is: a. Usually involve ionic bondingb. Always contain a small number of atomsc. Always contain carbon and hydrogend. often associated with nonliving matte 3. Splitting of a bond by adding water refers to:a. A hydrolysis reactionb. A dehydration synthesis reactionc. Acid-base reactiond. All of the above4. The class of molecules that includes monosaccharides,...
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more: a. atgtaacagcatccagaaaaaaagtattga O b. atgtcccaacatgataagaacttcaaccat □ catgagccaggcagttatagaaaaaccgcat datgagccagcataacgaaaaaaacccgcat
Which of the following is a key difference between primary and secondary immunofluorescence? Select one: a. Primary immunofluorescence (but not secondary) uses a form of light microscopy to excite the fluorophore b. More than one of the listed characteristics are key differences between primary and secondary immunofluorescence c. Secondary immunofluoresence (but not primary immunofluorescence) is used when more than one antigen needs to be stained d. In primary immunofluorescence the antibody that recognizes the epitope of the antigen is also...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Which of the following is correct concerning a peptide backbone? Choose one: O A. The peptide bond allows for free rotation due to its single bond character. OB. A Ramachandran plot shows the allowable and V angles for a peptide. O C. The torsional angle between the Ca and the Rgroup is called “ (phi). O D. The torsional angle between the amide nitrogen and the Ca is called (psi).
Are these answers correct?
For the following list of peptides, predict which peptide would elute from the column first. Note that all conditions below are based on the fact that the separation is being performed at pH 7. Peptide Name Sequence AGVILPVYATIGSGIVNPAFPVVSLEVVLER GTADVTPDLEEMK QPILIAVVLOLSQQLSGINAVFYYSTSIFEK LMLAVGGAVLGSLQFGYNTGVİ NAPOK VTILELFR Not changed since last attempt Marked out of 2.00 Question 5 Which peptide would elute last from a column that separates ONLY on hydrophobicity? Select one: Not changed since last attempt Marked...
1. Given the following peptide, which of the following
statements is true?
Question options:
a) The N-terminal residue is leucine.
b)This peptide contains 4 amino acid residues.
c) The peptide contains a total of 6 ionizable groups.
d) The net charge of this peptide at pH 7 is +1 Locate any
peptide bond along the backbone of the given peptide.
e) The bond between the C (of the C=O) and the N (of the N-H) of
a peptide bond has...
Most questions answered within 3 hours.
-
You look at yourself in a shiny 9.6-cm-diameter Christmas tree
ball.
If your face is 21.0...
asked 21 seconds ago -
If we were to measure the relaxation time of a muscle after
undergoing tetanus compared to...
asked 3 seconds ago -
4CO(g) + 8H2(g) -----> 3CH4(g) +
CO2(g) + 2H2O(l)
Use the following data as needed to...
asked 3 minutes ago -
without using map
1. Write a C++ program to find out the top 10 words in...
asked 16 minutes ago -
1)Calculate the percent ionization of a
0.330 M solution of hypochlorous
acid.
% Ionization = %...
asked 19 minutes ago -
1a) How many grams of K2SO4 are in 250mL
of 0.11 M K2SO4 solution?
_____ g...
asked 10 minutes ago -
The vapor pressure of a solution containing 38.7 g glycerin
(C3H8O3) in 146.2 g ethanol (C2H5OH)...
asked 15 minutes ago -
A physics major is cooking breakfast when he notices that the
frictional force between the steel...
asked 20 minutes ago -
A cyclohexane (c-hex) solution is prepared by fully dissolving
9.11g of a newly synthesized organic compound...
asked 26 minutes ago -
SCHEME :-)
[5 marks] Write a procedure called convert that takes as
arguments: a temperature value...
asked 32 minutes ago -
Are
Acetyl CoA and Pyruvate biological molecules that are used to get
ATP energy in aerobic...
asked 33 minutes ago -
Two waves are traveling on a string, one with a wave function,
y1 = 0.05sin(4x -...
asked 41 minutes ago