(d) In primary immunofluorescence the antibody that recognises the epitope of the antigen is also the one covalently linked with the fluorophore
In primary/direct immunofluorescence, the primary antibody is the only antibody used for udentification of the antigen and is labelled with the fluorophore.
In secondary/indirect immunofluorescence, two antibodies are used for detection of the antigen - primary and secondary. The primary antibodies are unlabelled, while the secondary antibodies are labelled with the fluorophore which binds to the primary antibodies.
Which of the following is a key difference between primary and secondary immunofluorescence? Select one: a....
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
AnswerB only which I marked Sample 4: Primary antibody: W6/32 (MHC class 1) Secondary antibody: rabbit anti-mouse FITC Condition: 4°C Please note: this image shows six cells at a smal scale than sample 3 Sample 3: Primary antibody: W6/32 (MHC class 1) Secondary antibody: rabbit anti-mouse FITC Condition: 22°C Please note: this image shows one single cell that has been enlarged Table 1 Experimental conditions and antibodies. Experimental conditions Primary antibody staining Secondary antibody staining Secondary Secondary antibody antibody type...
Help Save & En s the following statement correct (true) or incorrect (false)j? with Big Data because querying related Tables (le. tables that are linked using Primary and Foreign Key Relationship containing Big Data requires more secondary memory than what current computers can support." True or Faise True False < Prey 25 of 2SⅢ Next> for working with large Data in tables within relational database MacBook Pro 5 6 8 9 0 0 Help Save & En s the following...
The employee is table, the best candidate for primary key is Select one: a. Department ID b. Employee hiredate c. Employee ID d. Employee salary Question 2 A primary key can be composed of more than one attribute. Select one: True False Question 3 A foreign key allows you to join two tables. Select one: True False Question 4 Given two tables, department (dept_id, dept_location, dept_name) and EMPLOYEE(emp_id, emp_name, emp_dept_id, emp_name, emp_salary), which attribute (column) is the foreign key? Select...
Which of the following is a difference between dialogic organizational development (OD) and diagnostic organizational development (OD)? Select one: 1. Dialogic OD uses the processes of unfreeze, change, and freeze to manage change, whereas diagnostic OD uses no systematic steps to manage change. 2. The practitioners of dialogic OD carry out diagnosis of the organizational situation before intervening, whereas the practitioners of diagnostic OD work with people in a way that creates new knowledge and awareness. 3. A consultant is...
Answer the following questions. 1. Which of the following is a key difference between firms in a perfectly competitive industry and firms in a monopolistically competitive industry? (Choose only one) a) A monopolistically competitive firm does not face entry from other firms. b) A monopolistically competitive firm does not have the exact same product as other firms. c) A monopolistically competitive firm does not choose a level of output where marginal cost is equal to marginal revenue. d) A monopolistically...
1. Fill out the following table by indicating which general technique (light microscopy (LM) or electron microscopy (EM]) could be used to observe each structure or phenomenon. Put "no" in the box if the technique could not be used. If light microscopy can be used, name one technique (bright-field, phase-contrast, fluorescence, etc.) that you think would be effective. You will find some useful information in Appendix 1 of this manual and Chapter 18 of your textbook. Structure or phenomenon Could...
Which of the following describes a fundamental difference between commensalism and mutualism? Select one: a. Mutualism benefits both parties, but commensalism benefits one party. b. Mutualism is not obligate, but commensalism is obligate. c. Mutualism benefits both parties, but commensalism benefits neither party. d. Mutualism is obligate, but commensalism is not obligate. Question 2 The climax community is a stable and predictable early stage of succession. True False Question 3 Beavers build dams that make ponds in streams, thus creating...
(DBA Level )Tick the right answer (only 1 is correct): 1. Which of the following does NOT apply to quantitative research? It uses the scientific method It gives rise to less reliable data than qualitative research It aims to describe, explain and predict phenomena Its methods are tighter and more rigorous than in qualitative research 2. What is the correct ordering of the stages involved in planning research? Formulate the hypothesis, carry out the study, design the study,...
hello I need help asap please 01:48:4 1 2. Any agent that can bind to a component of the immune system and activate an immune reaction is referred to as an: A. Antagonist B. Allograft C. Antigen D. Antibody 3. First-aid directives for injury-related inflammation often recommends this four-step approach: A O Heat, elevation, drugs, exercise B. ORest, ice, compression, elevation C. O Rest, heat, compression, drugs D. O Exercise, elevation, ice followed by heat 6:07 PM 36) 6/2/2019 20...