Answer-
According to the given question-
gene mutated | Molecule supplemented | Growth or no growth |
arg E | Citruline | no growth |
arg F | Glutamate | no growth |
arg G | Ornithine | no growth |
arg G | Citruline | no growth |
arg H | Arginine | no growth |
arg G | Arginosuccinate | no growth |
E - glutamic acid , F -
phenylalanine , G- glycine , H- histidine
table for reference for question 4 table h ell-free synoms produce Golshopecule consisting of a string...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...