In high-throughput sequencing, the primers bind to a) oligonucleotides attached to the fragments. b) free dNTPs....
In high-throughput sequencing, the primers bind to
a) oligonucleotides attached to the fragments.
b) free dNTPs.
c) DNA polymerase.
d) the sequence fragments themselves.
e) nothing.
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
In high-throughput sequencing, the primers bind to
a) oligonucleotides attached to the fragments.
b) free dNTPs....
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
please answer this question with a correct and concise explanation, thank you so much! 1 QUESTION...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the...
Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the desired region to be amplified. b) PCR primers must be outside the region of interest. c) PCR primers must be flanking the region of interest. d) Sequencing primers must be flanking the region of interest. e) All of the nucleotides used in Sanger Sequencing would also be able to be used for a PCR reaction where you are trying to amplify a gene of...
The observation that in any DNA sample, A T and G C A. DNase sequencing An...
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are
lacking a OH at the
a.
2' carbon
b.
5' carbon
c.
3' carbon
please answer as many as you can!! I am low on questions and
could use the help!
Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...
Read the following abstract: "The advent of high-throughput sequencing led to breakthroughs in microbiome analysis and...
Read the following abstract: "The advent of high-throughput sequencing led to breakthroughs in microbiome analysis and to an explosion of bacterial genomes being released in public repositories. However, many microbiotas cannot be cultured in the lab without introducing drastic changes in the underlying bacterial communities and the distribution of genomes present in online repositories is heavily skewed towards organisms that are amenable to culturing. Those that cannot (or should not in the case of dangerous pathogens) be cultured are often...
All cells in a mouse are genetically identical, yet many cells like brain or liver cells...
All cells in a mouse are genetically identical, yet many cells like brain or liver cells perform specialized functions. How do these cells achieve this level of specialization? a. Through transcription factor activity b. Through alternative splicing of mRNA c. Through the accumulation of mutations d. Through gene silencing e. Through post-translational modifications Which material would not be required for determining the sequence of a 400 bp DNA fragment by the high-throughput sequencing method? a. A short, artificially synthesized primer...
A good enzyme for use in an immunoassay should have a: A. rapid degradation rate. B....
A good enzyme for use in an immunoassay should have a: A. rapid degradation rate. B. high substrate conversion rate. C. high cost. D. toxic enzymatic product. What is the basis of strand displacement amplification? A. Two different primers bind to the same strand of DNA. B. Two different primers each bind to complementary strands of DNA. C. Multiple primers bind to fragmented DNA targets. D. Primers are joined together. For a probe to hybridize to the target, which condition...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration;...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are
lacking a OH at the
a.
2' carbon
b.
5' carbon
c.
3' carbon
please answer as many as you can!! I am low on questions and
could use the help!
Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...
All cells in a mouse are genetically identical, yet many cells like brain or liver cells perform specialized functions. How do these cells achieve this level of specialization? a. Through transcription factor activity b. Through alternative splicing of mRNA c. Through the accumulation of mutations d. Through gene silencing e. Through post-translational modifications Which material would not be required for determining the sequence of a 400 bp DNA fragment by the high-throughput sequencing method? a. A short, artificially synthesized primer...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
Most questions answered within 3 hours.
-
The free energy change for the following reaction at 25 °C, when
[Sn2+] = 1.17 M...
asked 3 minutes ago -
An MNE is this kind of industry when competition in one country
is essentially independent of...
asked 1 hour ago -
. For this set of questions, determine what
proportion of a normal distribution is located betweeneach...
asked 2 hours ago -
A college student is employed as a door-to-door newspaper
salesman. Historical data suggests that the student...
asked 3 hours ago -
MATLAB HW 11 problem using Switch Case and Input commands
Write a script file that calculates...
asked 2 hours ago -
Considering gravitational time dilation, calculate the time that
passes in Earth’s surface while 1 hour passes...
asked 3 hours ago -
Minitab Problem: Take the Lake Hume June rainfall data and find
use the processes outlined in...
asked 4 hours ago -
X Company is trying to decide whether to continue using old
equipment to make Product A...
asked 4 hours ago -
IN PYTHON ONLY !! Program 2: Re-work
program #5 (WeeklyHours) from the previous assignment such that...
asked 4 hours ago -
The average length of time between arrivals at a turnpike
toll-booth is 26 seconds. What is...
asked 6 hours ago -
(a) A piston at 6.1 atm contains a gas that occupies a volume of
3.5 L....
asked 7 hours ago -
Please answer true or false. Words
cannot be changed or added in to make it true...
asked 7 hours ago