Question

Which of the following is the LEAST likely direct consequence of a substitution mutation? creating a...

Which of the following is the LEAST likely direct consequence of a substitution mutation?

creating a non-functional version of a protein

creating a new version of a protein

creating a new amino acid in the universal genetic code

creating a different codon in a gene

creating a new allele of a gene

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The consequence of substitution mutation which is LEAST likely to occur directly is CREATING A NEW ALLELE OF A GENE.

This is because by substitution mutation can cause the formation of a non functional version of a protein, in caser the substitution leads to the formation of stop codons, the protein syhnthesis will stop.

A new version of protein can also be formed, for example in Sickle cell Anaemia, Glutamic acid is changed to Valine, by substitution at a single base.

New amino acid formation in the genetic code is also possible as well as different codon can be formed, but a new allele can not be generated because the allele are identical copies of a gene having same contrasting characters, which cannot be formed by a base substitution mutation

Add a comment
Know the answer?
Add Answer to:
Which of the following is the LEAST likely direct consequence of a substitution mutation? creating a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A substitution mutation is one in which one nucleotide base is changed to another

    2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...

  • The gene encoding protein Bog in E. coli has been changed by a point mutation in...

    The gene encoding protein Bog in E. coli has been changed by a point mutation in its open reading frame. Originally the gene encoded a 108 amino acid long functioning protein whose amino acid composition favored nonpolar and negatively charged amino acids. After the mutation it encodes a 110 amino acid long non-functioning protein that is now rich in polar uncharged amino acids and positively charged amino acids. Which mutation scenario best explains this observation. A) A frame-shift caused by...

  • 4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a...

    4. A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. According to the genetic code, is this mutation a transition or a transversion? At which position of the codon does the mutation occur? 2 pts

  • Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in...

    Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________­­, and the resulting protein has ______________. a) only one codon / at least three amino acid changes b) three codons / a single amino acid change c) only one codon / a single amino acid change d) three codons / three amino acid changes

  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...

    Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...

  • A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heteroz...

    Can someone please help me with numbers 4 and 5? A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...

  • 1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning...

    1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly? photoreactivation repair base excision repair SOS repair double-strand break repair nucleotide excision repair 2. In bacteria and eukaryotes, a mutation is when ________. In bacteria and eukaryotes, a mutation is when ________. A.the nucleotide sequence in an mRNA molecule is directly changed B.the nucleotide sequence in a DNA molecule is directly changed C.the amino acid sequence in a protein molecule is directly changed...

  • Please help me with biology 1. Online exercise: Find reports that document the relationship between the...

    Please help me with biology 1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...

  • The genetic code is read in groups of three (3) nucleotides called codons. Some mutations are...

    The genetic code is read in groups of three (3) nucleotides called codons. Some mutations are silent because they have no effect on the phenotype. How is that possible? Since there was a mutation in one of the codons, that gene will not be expressed. o It is not possible, mutations are always expressed and always have an effect The mutation changed the codon but the new codon codes for the same amino acid The ribosome knows there was a...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT