ASAP please ..
Hey, I need help answering these questions, about the introduction
of an article about HIV inhibition using adenovirus-delivered
CRISPR/CAS9. Thaanks!!
Ans 1: The main idea of paragraph 1 is to carry out nuclease mediated genome editing using CRISPR/Cas9 technique so as to introduce double stranded break in the targeted DNA using Cas9 which will result in errors during repairing mechanism in the viral genome which is integerated in human genome.
And 2 : Using pair of sgRNAs, LTR of HIV virus (which are the sequences through which HIV intergerate in human genome) can be chopped off resulting in removal of provirus which makes cells to become resistant to HIV infection.
ASAP please .. Hey, I need help answering these questions, about the introduction of an article...
Please help me answering these multiple questions of how the CRISPR system works, thank you! 1. Match the CRISPR component with its function. (matching the upper case letters to the lower case letters) A). Cas9 B). gRNA (sometimes called sgRNA) C). Non-homologous End Joining (NHEJ) D). Homology-directed Repair (HDR) a). A short RNA molecule that guides a DNA cutting enzyme to a specific location in genomic DNA. b). A type of DNA repair mediated by a set of enzymes all...
Hello. I am working on these genetics questions and cant seem to figure these out. if you could help i would greatly appreciate it. Question 7 (1 point) CRISPR/Cas9 is often used to make mutations in zebrafsh Which statement is most correct? Capping the sgRNA is essential for its stability. The Cas9 mRNA is is used to target the native Cas9 protein to the locus to be mutated. the sgRNA uses DICER to cut up a the twenty nucleotide target...
7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the sequence in the _____ direction; _____ fragments that were terminated _____ in polymerization move faster down the gel a. bottom to top; 5′ to 3′; shorter; early b. top to bottom; 5′ to 3′; longer; early c. bottom to top; 5′ to 3′; longer; later d. top to bottom; 5′ to 3′; shorter; early e. bottom to top; 3′ to 5′; shorter; early 8....
1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence. You extract genomic DNA from each of the cells. Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...
please help answer these questions 3. What are the similarities, differences, advantages, and disadvantages of CRISPR-based gene editing versus Zinc-finger nucleases and TALENS? 4. What is crRNA and what does it do? 5. What is tracrRNA and what does it do? 6. What is the PAM sequence and what is its significance? 7. What can nuclease-deficient Cas9 (acas) proteins be used for? 8. You want to insert DNA encoding an epitope tag to the end of a specific gene you...
Please have a different answer than the other post, and use layman's terms as well hhmi Biolnteractive Using CRISPR to identify the Functions of Butterfly Genes Activity Student Handout This document is made available by the Howard Hughes Medical Institute. Using this document, you agree to use this document in accordance with the Terms of Use. INTRODUCTION Scientists have determined the complete DNA sequences of the genomes for many organisms, including humans. By analyzing patterns in those sequences, they can...
1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...
For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...
please answer All the multiple choice questions in the pic (all pics) i dont need a explantion . 22 Using a bacteriophage to pass DNA rom bacterium to another O A) Transduction O B) Transformation C) Translocation O D) Translation 23. What research did Rosalind Franklin contribute to the elucidation of the double helix structure of DNA? O O O A) Principles of base pairing B) Biochemical data C) Bacterial transformation data D) X ray crystallography A segment of DNA...
QUESTION 1 MC. Which of the following disease conditions might NOT be treatable by RNAI? a. arthritis b. Cancer caused by tumor suppressor gene mutation c. macular degeneration d. cancer caused by oncogen mutation S 5 QUESTION 2 MC. What is the molecular cause of male courtship behavior in fruit flies? a. Alternative splicing of the fruitless transcript b. RNA editing of the fruitless transcript C. Alternative sequence of the fruitless DNA d. Alternative 3' cleavage and polyadenylation of fruitless...