Question

ASAP please ..
Hey, I need help answering these questions, about the introduction of an article about HIV inhibition using adenovirus-delivered CRISPR/CAS9.  Thaanks!!
strand, resulting in double-stranded breaks (DSBs) that trigger cellular repai mechanisms. In eukaryotes, the DSBs are more commonly repaired by the mechanism ot error prone non ho mologous end joining (NHEJ), therefore generating sequence changes, for instance insertions and deletians (indels), around the DSBs. Owing to the simplicity of manipulation and versati ity, the CRISPR/Cas9 system has been utized as an attractive tool tor various applications, such as genome widc screening, gene repression and activation, targeted fluorescence imaging and novel approaches against pathogens including hepatitis B virus, human papillomavirus, Epstein-Barr virus, malaria and INTRODUCTION More than 33 years have elapsed since the first reported case of AIDS. Although the introduction of effective antiretro- viral therapy (ART) has resulted in huge reductions in rates ot human immunodeficiency virus type 1 (IV-1) illness, IHlV-1 in- fection remains incuable. In addition, ART encounters a num ber of challenges, including a persistent latent viral reservoir, the requirement for lifelong adherence, and the potential de velopment of drug resistance and toxicity. Thus the develop ment of novel therapeutic methods that may enhance current therapeutic options and even lead to curative approaches would significantly expand our portfolio of strategies to coun- teract HIV-1/AIDS. 1, what was the main idea of paragraph #1? 2. what are the main ideas of paragraph #2? 3. There are three significant challenges listed in this paragraph. List them and briefly describe why they are challenges End of document Using a pai of sBRNAs targeting the LTR of HIV-1, it was shown that HIV-1 provirus can be removed from the genone of infected cell lines. By combining TALEN or CRISPR/Cas9 with PiggyBac technology, researches have generated induced pluripotent stem cells (iPSC hamozygous for the naturally oc- curring CCR5D3 variant resistant to HIV-1 infection. How- ever, owing to the large size of the Cas9 codin sequence with a total length of more than 5 kb when combining with sgRNA, promoters and other essential clements for etficient expres sion, delivery of CRISPR/Ca for instance, CD4T-lymphocytes, the primary target for HIV 1 infection i vivo, reains challeging. In the cuent study after optimized design and screening of a panel of sgRNAs in cell lines, we obtained several sgRNA sequences with high po tency to target CCRS. By utilizing a chimeric adenoviral we demonstrated the efficacy of CCR5 editing and established HIV-1 resistance in primary CD4+ T-cells. Nuclease-mediated genome editing represents one promising strategy for HIV-1 therapy. Nucleases including zinc finger nuclease (ZFN) and transcription activator-like effector nuclease (TALEN) recognize genome locus based on prot DNA interactions. By construction of a tandem array of vari ous artiticially engineered modules, ZFN and TALEN can target virtually any DNA sequence. However, these two technologies to some extent present limitations and remain not only tech- nically complex but al laborious and time-csurning to ma- nipulate. Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) and associated protein 9 (Cas9), derived from a type II CRISPR/Cas system naturally existent in bacteria, has been harnessed as a novel nuclease tool to me- diate genome editingi mnalian cells. By simple delivery of two essential components, a human codon-optimized Cas9 protein and a single guided RNA (SgRNA), the CRISPR/Cas9 complex formed can be programmed to target any genomic lacus followed by a 59-protospacer adjacent motif (PAM) se- quence of NGG, with the specificity determined by the sgRNA containing a 20 nt guide sequence complementary to the nome locus of interest. Upon the guidance of sgRNA, Cas9 protein is programmed to cleave the targeted DNA at each s9 components into primary cells,

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans 1: The main idea of paragraph 1 is to carry out nuclease mediated genome editing using CRISPR/Cas9 technique so as to introduce double stranded break in the targeted DNA using Cas9 which will result in errors during repairing mechanism in the viral genome which is integerated in human genome.

And 2 : Using pair of sgRNAs, LTR of HIV virus (which are the sequences through which HIV intergerate in human genome) can be chopped off resulting   in removal of provirus which makes cells to become resistant to HIV infection.

Add a comment
Know the answer?
Add Answer to:
ASAP please .. Hey, I need help answering these questions, about the introduction of an article...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please help me answering these multiple questions of how the CRISPR system works, thank you! 1....

    Please help me answering these multiple questions of how the CRISPR system works, thank you! 1. Match the CRISPR component with its function. (matching the upper case letters to the lower case letters) A). Cas9 B). gRNA (sometimes called sgRNA) C). Non-homologous End Joining (NHEJ) D). Homology-directed Repair (HDR) a). A short RNA molecule that guides a DNA cutting enzyme to a specific location in genomic DNA. b). A type of DNA repair mediated by a set of enzymes all...

  • Hello. I am working on these genetics questions and cant seem to figure these out. if...

    Hello. I am working on these genetics questions and cant seem to figure these out. if you could help i would greatly appreciate it. Question 7 (1 point) CRISPR/Cas9 is often used to make mutations in zebrafsh Which statement is most correct? Capping the sgRNA is essential for its stability. The Cas9 mRNA is is used to target the native Cas9 protein to the locus to be mutated. the sgRNA uses DICER to cut up a the twenty nucleotide target...

  • 7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the...

    7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the sequence in the _____ direction; _____ fragments that were terminated _____ in polymerization move faster down the gel a. bottom to top; 5′ to 3′; shorter; early b. top to bottom; 5′ to 3′; longer; early c. bottom to top; 5′ to 3′; longer; later d. top to bottom; 5′ to 3′; shorter; early e. bottom to top; 3′ to 5′; shorter; early 8....

  • 1) You have two human liver cells (A and B) and you hypothesize that the insulin...

    1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence.  You extract genomic DNA from each of the cells.  Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...

  • please help answer these questions 3. What are the similarities, differences, advantages, and disadvantages of CRISPR-based...

    please help answer these questions 3. What are the similarities, differences, advantages, and disadvantages of CRISPR-based gene editing versus Zinc-finger nucleases and TALENS? 4. What is crRNA and what does it do? 5. What is tracrRNA and what does it do? 6. What is the PAM sequence and what is its significance? 7. What can nuclease-deficient Cas9 (acas) proteins be used for? 8. You want to insert DNA encoding an epitope tag to the end of a specific gene you...

  • Please have a different answer than the other post, and use layman's terms as well hhmi...

    Please have a different answer than the other post, and use layman's terms as well hhmi Biolnteractive Using CRISPR to identify the Functions of Butterfly Genes Activity Student Handout This document is made available by the Howard Hughes Medical Institute. Using this document, you agree to use this document in accordance with the Terms of Use. INTRODUCTION Scientists have determined the complete DNA sequences of the genomes for many organisms, including humans. By analyzing patterns in those sequences, they can...

  • 1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the...

    1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...

  • For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a...

    For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...

  • please answer All the multiple choice questions in the pic (all pics) i dont need a...

    please answer All the multiple choice questions in the pic (all pics) i dont need a explantion . 22 Using a bacteriophage to pass DNA rom bacterium to another O A) Transduction O B) Transformation C) Translocation O D) Translation 23. What research did Rosalind Franklin contribute to the elucidation of the double helix structure of DNA? O O O A) Principles of base pairing B) Biochemical data C) Bacterial transformation data D) X ray crystallography A segment of DNA...

  • QUESTION 1 MC. Which of the following disease conditions might NOT be treatable by RNAI? a....

    QUESTION 1 MC. Which of the following disease conditions might NOT be treatable by RNAI? a. arthritis b. Cancer caused by tumor suppressor gene mutation c. macular degeneration d. cancer caused by oncogen mutation S 5 QUESTION 2 MC. What is the molecular cause of male courtship behavior in fruit flies? a. Alternative splicing of the fruitless transcript b. RNA editing of the fruitless transcript C. Alternative sequence of the fruitless DNA d. Alternative 3' cleavage and polyadenylation of fruitless...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT