Answer:
3).
Sequence: 3′- TGCAATC- 5′
mRNA------5'- ACGUUAG-3'
Explanation:
A(DNA) = U(mRNA)
T(DNA) = A(mRNA)
C(DNA) = G(mRNA)
G(DNA) = C(mRNA)
3. A specific area of a chromosome has the following sequence of nucleotides. 3′- TGCAATCO.5′ During...
At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opened to form a replication fork: 3' C C T A G G C T G C A A T C C 5' A 7-nucleotide RNA primer is formed starting at the underlined T (T) of the template. What is the primer sequence, including 5' and 3' end? The "T" in bold is the underlined T.
What would be the correct complimentary sequence for this sequence of nucleotides during DNA replication: 5’-AGGCGCA-3’? Select one: a. 3’-TCCGCGT-5’ b. 3’-UCCGCGU-5’ c. 5’-TCCGCGT-3’ d. 3’-AGGCGCA-5’ e. 5’-UCCGCGU-3’
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of function may be encoded in a particular region of the genome. Which statement is true regarding sequence motifs? Sequence motifs are found in DNA and in corresponding RNA produced by transcription. Sequence motifs are telltale sequences of nucleotides that indicate possible function. An open reading frame (ORF) is a type of sequence motif. Sequence motifs help identify sequences that encode protein-coding genes. All of...
Below is shown an 8kb region of the human genome, with the
proportion of the nucleotides that are identical between the human
sequence and the homologous sequence from mouse on the top graph,
and the location of sequences mapped from an RNA-sequencing
experiment on the bottom graph
What region is likely to be an
enhancer element upstream of the promoter?
What region is likely to be an enhancer element in an
intron?
100 % conservation RNA-seq 2000 4000 6000 8000...
Question 10 A human chromosome has 3 origins of replication. Assuming that all 3 origins of replication are used at the same time, what is the maximum number of helicases present on DNA during DNA replication (not including DNA repair)? 12 O 3 O2 Question 11 Which of the following correctly compares primase and telomerase? O Both primase and telomerase synthesize DNA using a DNA template. O Primase synthesizes RNA using an RNA template, but telomerase synthesizes DNA using a...
Which of the following statements is FALSE? Nucleotides are only ever linked to one another 5’ to 3’ DNA can contain Uracil as a result of a chemical reaction MutS/MutL only works to repair the lagging strand of synthesis Alternative splicing happens in every eukaryotic gene All of these statements are false The protein that phosphorylates the CTD to initiate transcription is called EF-Tu eIF4 TFIID TFIIH RNA polymerase Which of these enzymatic activities in DNA replication require the input...
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...