1. Indicate the nucleotide that is complementary to the sequence shown (ie. can form base pair...
1. Indicate the nucleotide that is complementary to the sequence shown (ie. can form base pair interactions along the entire length of the DNA sequence shown. Be sure to indicate your
complementary DNA molecule sequence in the 5’-3’ direction:
5’- ACGTGTGAGATGGTCCGAGT - ’3
Homework Answers
In the DNA strand, A pairs with T and G pairs with C. The complementary strand is in 3'-5' direction.
Complementary DNA : 3'- TGCACACTCTACCAGGCTCA -5'
From 5'-3' direction,
5' - ACTCGGACCATCTCACACGT - 3'
Add Answer to:
1. Indicate the nucleotide that is complementary to the sequence
shown (ie. can form base pair...
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O...
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
Please help me to answer this: Give the base sequence of the complementary DNA strand of...
Please help me to answer this: Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5' ACGTAG 3'
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Constants Periodic Table Write the base sequence and indicate the 3' and 5' ends of the...
Constants Periodic Table Write the base sequence and indicate the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences. n Part A 5'AAAA3 Submit Request Answer Part B 5 CCCCTTTT3 Submit Request Answer Part 5'ACATTGG3 Search 17 of 25 . adenine 8.gua Write the base sequence and indicate the 3' and 5 ends of the complementary strand for a segment of DNA with the following base sequences. Constants Periodic Table 5CCCCTTTT3'...
C6) (8 points) a) Draw a GC base pair, such as one would see in a...
C6) (8 points) a) Draw a GC base pair, such as one would see in a standard B form DNA double helix. Include the full structure of each nucleotide in the base pair and use dashed lines to indicate the specific hydrogen bonding interactions between the bases. b) Briefly explain why you would expect to see a higher portion of guanine and cytosine bases (compared to thymine and adenine) in the DNA sequences of thermophilic bacteria (i.e. bacteria that live...
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Constants Periodic Table Write the base sequence and indicate the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences. n Part A 5'AAAA3 Submit Request Answer Part B 5 CCCCTTTT3 Submit Request Answer Part 5'ACATTGG3 Search 17 of 25 . adenine 8.gua Write the base sequence and indicate the 3' and 5 ends of the complementary strand for a segment of DNA with the following base sequences. Constants Periodic Table 5CCCCTTTT3'...
C6) (8 points) a) Draw a GC base pair, such as one would see in a standard B form DNA double helix. Include the full structure of each nucleotide in the base pair and use dashed lines to indicate the specific hydrogen bonding interactions between the bases. b) Briefly explain why you would expect to see a higher portion of guanine and cytosine bases (compared to thymine and adenine) in the DNA sequences of thermophilic bacteria (i.e. bacteria that live...
Most questions answered within 3 hours.
-
1. Review the Nike’s marketing strategy. You must include the
company’s target market, possible market segmentation,...
asked 10 minutes ago -
One of the major advantages of ______________ is to enhance
security for private networks by keeping...
asked 16 minutes ago -
Book:
Title: Framework for
Marketing Management, 15th edition
Author/s: Philip T.
Kotler, Kevin Lane Keller
1....
asked 25 minutes ago -
Given Uber’s recent corporate turbulence and ongoing
initiatives, provide a holistic situational analysis of the
environment...
asked 28 minutes ago -
A sculptor has hung up a 42.0 kg horizontal rod of length 4.80 m
. One...
asked 32 minutes ago -
What is the purpose of the 2' hydroxyl group in RNA? What is
the reason this...
asked 50 minutes ago -
You currently have 20,000X ethidium bromide. You want to make
250 mL of 1X ethidium bromide...
asked 1 hour ago -
What mass of lead is needed to absorb 348 J of heat if the temp
of...
asked 1 hour ago -
Explain the difference between an auction with reserve
and an auction without reserve. if not specified,...
asked 1 hour ago -
Write the net ionic equation for the precipitation reaction that
occurs when aqueous solutions of aluminum...
asked 1 hour ago -
How do we find the slope distance, given the horizontal distance
and the zenith angle?
For...
asked 1 hour ago -
The table to the right lists probabilities for the corresponding
numbers of girls in three births....
asked 1 hour ago