a) Would there be any problem in expressing the two genes?
b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
a) Would there be any problem in expressing the two genes?
Answer: No, as synthesis will take place from 5' to 3' end so both the strand will not pose any hindrance to each other transcription process.
b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
Answer: as if mutation is there in protein A that means mutation is also there in protein B because the strands they used as template are complementary to each other so any change in one strand will cause changes in the other strand too. it is very likely that there may be structural change in protein B too.
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed...
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
Some genes are transcribed using one strand of DNA as the template, while other genes are transcribed using the other strand. Explain how this is possible and why this is advantageous to the cell, and for storing genetic information.
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...