The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?
Homework Answers
If the recognition sequence for the restriction enzyme BamHI is '5-G/GATCC-3' on one strand, the recognition site on the complementary strand 3'-CCTAG/G-5' because the restriction site of the restriction enzyme recognized mostly palindromic sequence (mirror image of each other). So, the complementary strand has same sequence in 5' to 3' direction. The restriction enzyme BamHI cuts the DNA in the following manner:-
Add Answer to:
The recognition sequence for the restriction enzyme
BamHI is '5-GGATCC-3' on one strand. What would be...
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky...
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky end. Draw the structure of this sequence after it has been cleaved by this enzyme. Abbreviate the nitrogenous bases fully but completely draw the backbone structure of both strands.
Which enzyme would cut this strand of DNA: GCATGGATCCCAATGC? Enzyme Recognition BamHI G¯GATCC...
Which enzyme would cut this strand of DNA: GCATGGATCCCAATGC? Enzyme Recognition BamHI G¯GATCC CCTAG↑G Enzyme Recognition EcoRI G¯AATTC CTTAA↑G Enzyme Recognition HaeIII GG¯CC CC↑GG Enzyme Recognition HindIII A¯AGCTT TTCGA↑A Enzyme Recognition PstI CTGCA¯G G↑ACGTC
Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary...
Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary strand as well. i) BamHI 5’ ATCGGGATCCTA 3’ ii) BgIII 5’ GCTCTGCAGATCTA 3’?
Which of the following may represent one strand of a typical restriction enzyme recognition site? (CHOOSE...
Which of the following may represent one strand of a typical restriction enzyme recognition site? (CHOOSE ONE ANSWER BELOW) A. 5’ GACGAC 3’ B. 5’ GACCAG 3’ C. 5’ GAGCTG 3’ D. 5’ GACGTC 3’
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
You cut the pBad-mTagBFP2 plasmid with the BamHI restriction enzyme only. There is only one BamHI...
You cut the pBad-mTagBFP2 plasmid with the BamHI restriction enzyme only. There is only one BamHI RE site. How many bands do you expect to see after you run the product on a gel? Would you expect the same result if you cut a linear PCR product that also only has one cut site? Explain your reasoning
match_enzymes: (str, List[str], List[str]) -> List[list] The return type is a list of two-item [str, List[int]]...
match_enzymes: (str, List[str], List[str]) -> List[list] The return type is a list of two-item [str, List[int]] lists The first parameter represents a strand of DNA. The last two parameters are parallel lists: the second parameter is a list of restriction enzyme names, and the third is the corresponding list of recognition sequences. (For example, if the first item in the second parameter is 'BamHI', then the first item in the third parameter would be 'GGATCC', since the restriction enzyme named...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
TRUE OR FALSE: 1. Base-pairing rules apply from one DNA strand to its partner, but not...
TRUE OR FALSE: 1. Base-pairing rules apply from one DNA strand to its partner, but not along the sugar-phosphate "handrails" of a DNA strand. 2. DNA polymerase cannot copy point mutations, so they are not passed on from parent cells to daughter cells in cell division. 3. It is not possible for a human gene to work in any other organism. 4. Mutations in regulatory DNA sequences may be more important to evolution than mutations in genes. 5. The enzyme...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
Most questions answered within 3 hours.
-
Consider the data in the following table regarding the age of a
particular model of car...
asked 16 seconds ago -
She estimates the following model as Rent = β0 + β1 Bedroom + β2
Bath +...
asked 21 minutes ago -
Prove that the following is a valid cumulative distribution
function
F(x) = x/(1+x) for a>=0
0...
asked 50 minutes ago -
Sal's satellite company broadcasts TV to subscribers in Los
Angeles and New York. The demand functions...
asked 12 minutes ago -
1. Sketch the expected Mass Spectrum of Pentane (C5H12)
2. Draw the most stable Newman projection...
asked 48 minutes ago -
Russel Wisselink “Have a plan ready for me by 9:00 a.m. tomorrow
morning” was the instruction...
asked 16 minutes ago -
Write the balanced chemical equation for the reaction between
iodate and bisulfite. Does the order with...
asked 38 minutes ago -
how can you efficiently determine the number of atoms
in a sample of an element?
asked 23 minutes ago -
Calcium dihydrogen phosphate, Ca(H2PO4)2, and sodium hydrogen
carbonate, NaHCO3, are ingredients of baking powder that react...
asked 29 minutes ago -
a car starts from rest at a stop sign. It accelerates
at 4.4m/s² for 7.5s, coasts...
asked 44 minutes ago -
can you identify some rules of how R is calculated for a circuit
in series? For...
asked 36 minutes ago -
Design and implement your own linked list class to hold a sorted
list of integers in...
asked 44 minutes ago