Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary...
Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary strand as well. i) BamHI 5’ ATCGGGATCCTA 3’ ii) BgIII 5’ GCTCTGCAGATCTA 3’?
Homework Answers
1. The BamH1 recognition sequence is GGATTC so it cleaves the sequence so the following fragments are formed ,
Whereas the BgIII recognition site is AGATCT.
.
Add Answer to:
Show the resulting sequences when the sequence is cleaved by the
restriction enzyme. Show the complementary...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky...
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky end. Draw the structure of this sequence after it has been cleaved by this enzyme. Abbreviate the nitrogenous bases fully but completely draw the backbone structure of both strands.
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Most questions answered within 3 hours.
-
According to the network system security, please explain:
1- What is canary and how it does...
asked 36 minutes ago -
Study the provided BagInterface and the methods implemented in
the ResizableArrayBag
For the following methods that...
asked 34 minutes ago -
Enter your answer in the provided box. To what fraction of its
original volume, Vfinal/Vinitial, must...
asked 1 hour ago -
Can you figure out if any R functions used to subset a time
series 1 or...
asked 1 hour ago -
Which of the following is correct?
A. APC + MPS = 1
B. APS + MPS...
asked 1 hour ago -
Given a regression sum of squares equal to 2373.59 and a total
sum of squares equal...
asked 3 hours ago -
Compare and contrast the linear motion and angular motion
equations F ma and . That is,...
asked 2 hours ago -
Now that this course has taken you on a journey of introduction
to the world of...
asked 3 hours ago -
The sandwich maker of the EE-Cole-Eye Sandwich Truck was just
fired (for a reason described below)...
asked 5 hours ago -
Name the following coordination compounds using systematic
nomenclature.
1. [Co(H2O)6]Cl2:
2. [Cr(NH3)6](NO3)3:
3. K4[Fe(CN)6]:
4. Na[Au(CN)4]:...
asked 5 hours ago -
Propose an efficient synthesis of 2-Bromo-5-nitrotoluene from
benzene. Hint: 3 steps. Consider directing effects of substituents....
asked 7 hours ago -
This assignment will explore the impact of corporate decisions
on a local versus a global perspective....
asked 6 hours ago