11
During an in vitro translation assay, RNA molecules were used to
produce the following aminoacids (hypothetical example):
5’-UUCUUCUUCUUCUUC-3’ resulting in Phe, Ser, Leu
5’-UCUCUCUCUCUC-3’ resulting in Ser, Leu
5’-UUACUUACUUAC-3’ resultin in Leu, Thr, Tyr
According tot his experiment, which codons can be assigned to a
certain amino acid? Explain.
11 During an in vitro translation assay, RNA molecules were used to produce the following aminoacids...
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotides, or codon, is the basic unit of storage. The reason for this is that each gene codes for a protein, and all proteins are made from 20 amino acids. Recall that there are 4 different bases that make up dna. Thus, three bases can encode for 4x4x4 = 64 different symbols. Two base pairs can only encode for 4x4 = 16 symbols, which is...
all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...