1.
5'-G G G G G G C C C-3'
Enter the nucleotide sequence using the capitalized abbreviations.
2.
5'-A T G G C A-3'
Enter the nucleotide sequence using the capitalized abbreviations.
3.
5'-G G T A C T C C T G A C-3'
Enter the nucleotide sequence using the capitalized abbreviations.
1. 5'-G G G G G G C C C-3' Enter the nucleotide sequence using the...
Enter the corresponding section of mRNA produced from the following section of DNA template strand: 3' T T T G A A G C T C C A 5 Enter the nucleotide sequence using capitalized abbreviations. 5'_answer_3'
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Click in the answer box to activate the palette. 3- ATGGCCCATTACTTTCCCGTA -5' Only enter the letters representing the nucleotides.
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
Translate the following DNA sequence: DNA template: 3' G C T A C C G G A G T A A T A C T 5' What are the tRNA anticodons for the sequence? DNA template: 3' G C T A C C G G A G T A A T A C T 5' anticodon 1: 3' 5' anticodon 2: 3' 5' anticodon 3: . 3' 5' anticodon 4: 3' 5' anticodon 5: 3
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...